HRK (NM_003806) Human Untagged Clone

CAT#: SC303381

HRK (untagged)-Human harakiri, BCL2 interacting protein (contains only BH3 domain) (HRK)



  "NM_003806" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-HRK Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DP5; HARAKIRI
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_003806 edited
ATGTGCCCGTGCCCCCTGCACCGCGGCCGCGGCCCCCCGGCCGTGTGCGCCTGCAGCGCG
GGTCGCCTGGGGCTGCGCTCGTCCGCCGCGCAGCTCACCGCCGCCCGGCTCAAGGCGCTA
GGCGACGAGCTGCACCAGCGCACCATGTGGCGGCGCCGCGCGCGGAGCCGGAGGGCGCCG
GCGCCCGGCGCGCTCCCCACCTACTGGCCTTGGCTGTGCGCGGCCGCGCAGGTGGCGGCG
CTGGCGGCCTGGCTGCTCGGCAGGCGGAACTTGTAG
>OriGene 5' read for NM_003806 unedited
NGGGTTCATAATTTGTAAACGACTCACTATAGGCGGCCGCGAATCATGTGCCCGTGCCCC
CTGCACCGCGGCCGCGGCCCCCCGGCCGTGTGCGCCTGCAGCGCGGGTCGCCTGGGGCTG
CGCTCGTCCGCCGCGCAGCTCACCGCCGCCCGGCTCAAGGCGCTAGGCGACGAGCTGCAC
CAGCGCACCATGTGGCGGCGCCGCGCGCGGAGCCGGAGGGCGCCGGCGCCCGGCGCGCTC
CCCACCTACTGGCCTTGGCTGTGCGCGGCCGCGCAGGTGGCGGCGCTGGCGGCCTGGCTG
CTCGGCAGGCGGAACTTGTAGCTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCT
GAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAG
TTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTG
ACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAG
TTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGG
CACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCANC
CTCCCGAGTTGTTGGGGATTCCAGGCATGCATGACCAGGCTCAACTAAATTTTGGTTTTT
TGGTAGAGACCGGGGTTCACCATATTGGCCAAGCTGGTCCTCCACTCCTAATCTCAGGTG
ATCTACCCACCTGGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGGCCCCTTC
CCTGTCCTTTTGTTTTAAAAAACCACCCAGCCGGAGGACGTCCCGAACCCGATAGGGTAA
CTG
Restriction Sites Please inquire     
ACCN NM_003806
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003806.1, NP_003797.1
RefSeq Size 716 bp
RefSeq ORF 276 bp
Locus ID 8739
UniProt ID O00198
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the BCL-2 protein family. Members of this family are involved in activating or inhibiting apoptosis. The encoded protein localizes to intracellular membranes. This protein promotes apoptosis by interacting with the apoptotic inhibitors BCL-2 and BCL-X(L) via its BH3 domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the protein described in PMID: 9130713 and 9228060. This transcript is supported by BF510077.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously PMID: 18008329. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...