BARX2 (NM_003658) Human Untagged Clone

CAT#: SC303360

BARX2 (untagged)-Human BARX homeobox 2 (BARX2)



  "NM_003658" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-BARX2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303360 representing NM_003658.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACTGCCACGCCGAGCTGAGGCTGAGCTCGCCCGGCCAGCTCAAAGCAGCCAGGCGGCGCTACAAG
ACTTTCATGATCGACGAGATCCTCTCCAAGGAGACCTGCGATTACTTTGAGAAACTTTCCCTCTACTCC
GTGTGCCCGTCGCTGGTCGTGCGACCCAAGCCCCTGCATTCCTGTACGGGCTCCCCTTCCCTGCGGGCA
TATCCGCTCCTCTCGGTGATCACCCGCCAGCCCACTGTCATCTCCCACCTGGTCCCTGCCACCCCGGGA
ATCGCCCAGGCACTGTCCTGCCACCAGGTCACCGAGGCGGTCTCTGCTGAGGCCCCAGGGGGCGAGGCC
CTAGCCAGCAGCGAGTCAGAGACGGAACAGCCCACGCCCCGACAGAAGAAGCCCCGCCGGAGTCGCACC
ATCTTCACCGAGCTGCAGCTCATGGGCCTGGAGAAGAAATTCCAGAAGCAGAAGTATTTGTCAACCCCA
GACAGGTTGGACTTGGCTCAGTCTCTGGGACTCACTCAGCTGCAGGTGAAGACCTGGTATCAGAATCGC
AGGATGAAATGGAAGAAAATGGTTCTTAAAGGTGGACAGGAAGCACCCACAAAACCCAAAGGTCGCCCC
AAGAAGAACTCCATCCCCACATCAGAAGAGATTGAAGCTGAAGAGAAGATGAACAGCCAGGCCCAGGGT
CAGGAGCAGCTGGAGCCCTCTCAGGGGCAGGAGGAGCTCTGTGAAGCACAGGAACCGAAAGCACGTGAT
GTCCCCTTAGAGATGGCAGAGCCACCAGACCCGCCCCAGGAGTTGCCAATACCCTCTTCGGAACCCCCA
CCATTAAGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_003658
Insert Size 840 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003658.4
RefSeq Size 1767 bp
RefSeq ORF 840 bp
Locus ID 8538
UniProt ID Q9UMQ3
Protein Families Transcription Factors
MW 31.2 kDa
Gene Summary This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...