United States
Germany
Japan
United Kingdom
China
MASPIN (SERPINB5) (NM_002639) Human Untagged Clone
CAT＃: SC303231
SERPINB5 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5)
CNY 3,656.00
CNY 6,080.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | maspin; PI5 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002639 edited
TTTTCCAGGATAACTGTGACTCCAGGCCCGCAATGGATGCCCTGCAACTAGCAAATTCGG CTTTTGCCGTTGATCTGTTCAAACAACTATGTGAAAAGGAGCCACTGGGCAATGTCCTCT TCTCTCCAATCTGTCTCTCCACCTCTCTGTCACTTGCTCAAGTGGGTGCTAAAGGTGACA CTGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGAT TTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCA AGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGA GACCCTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAG GTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTG ACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCA AGTGGATGAAGAAATTTCCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGA CAGACACCAAACCAGTGCAGATGATGAACATGGAGGCCACGTTCTGTATGGGAAACATTG ACAGTATCAATTGTAAGATCATAGAGCTTCCTTTTCAAAATAAGCATCTCAGCATGTTCA TCCTACTACCCAAGGATGTGGAGGATGAGTCCACAGGCTTGGAGAAGATTGAAAAACAAC TCAACTCAGAGTCACTGTCACAGTGGACTAATCCCAGCACCATGGCCAATGCCAAGGTCA AACTCTCCATTCCAAAATTTAAGGTGGAAAAGATGATTGATCCCAAGGCTTGTCTGGAAA ATCTAGGGCTGAAACATATCTTCAGCGAAGACACATCTGATTTCTCTGGAATGTCAGAGA CCAAGGGAGTGGCCCTATCAAATGTTGTCCACAAAGTGTGCTTAGAAATAACTGAAGATG GTGGGGATTCCATAGAGGTGCCAGGAGCACGGATCCTGCAGCACAAGGATGAATTGAATG CTGACCATCCCTTTATTTACATCATCAGGCACAACAAAACTCGAAACATCATTTTCTTTG GCAAATTCTGTTCTCCTTAAGTGGCATAGCCCATGTTAAGTCCTCCCTGACTTTCTC |
| Restriction Sites | Please inquire |
| ACCN | NM_002639 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a good match to NM_002639.2 except for 3 SNPs. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002639.2, NP_002630.1 |
| RefSeq Size | 2558 bp |
| RefSeq ORF | 1128 bp |
| Locus ID | 5268 |
| UniProt ID | P36952 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | p53 signaling pathway |
| Gene Summary | Tumor suppressor. It blocks the growth, invasion, and metastatic properties of mammary tumors. As it does not undergo the S (stressed) to R (relaxed) conformational transition characteristic of active serpins, it exhibits no serine protease inhibitory activity.[UniProtKB/Swiss-Prot Function] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Maspin influences response to doxorubicin by changing the tumor microenvironment organization
,Triulzi, T;Ratti, M;Tortoreto, M;Ghirelli, C;Aiello, P;Regondi, V;Modica, MD;Cominetti, D;Carcangiu, ML;Moliterni, A;Balsari, A;Casalini, P;Tagliabue, E;,
Int. J. Cancer
,PubMed ID 24242003
[SERPINB5]
|
|
Targeting Serous Epithelial Ovarian Cancer with Designer Zinc Finger Transcription Factors *
,null,
The Journal of Biological Chemistry
,PubMed ID 22782891
[SERPINB5]
|
|
Targeting Serous Epithelial Ovarian Cancer with Designer Zinc Finger Transcription Factors
,Haydee Lara, Yuhua Wang, Adriana S. Beltran, Karla Juárez-Moreno, Xinni Yuan, Sumie Kato, Andrea V. Leisewitz, Mauricio Cuello Fredes, Alexei F. Licea, Denise C. Connolly, Leaf Huang, and Pilar Blancafort,
J. Biol. Chem., Aug 2012; 287: 29873 - 29886.
[SERPINB5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224287 | SERPINB5 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) |
CNY 3,656.00 |
|
| RC224287L1 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC224287L2 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), mGFP tagged |
CNY 5,890.00 |
|
| RC224287L3 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC224287L4 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), mGFP tagged |
CNY 6,056.00 |
|
| RG224287 | SERPINB5 (tGFP-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) |
CNY 5,256.00 |
