United States
Germany
Japan
United Kingdom
China
FGF4 (NM_002007) Human Untagged Clone
CAT＃: SC303106
FGF4 (untagged)-Human fibroblast growth factor 4 (FGF4)
CNY 2,400.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FGF-4; HBGF-4; HST; HST-1; HSTF-1; HSTF1; K-FGF; KFGF |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002007 edited
CATGTCGGGGCCCGGGACGGCCGCGGTAGCGCTGCTCCCGGCGGTCCTGCTGGCCTTGCT GGCGCCCTGGGCGGGCCGAGGGGGCGCCGCCGCACCCACTGCACCCAACGGCACGCTGGA GGCCGAGCTGGAGCGCCGCTGGGAGAGCCTGGTGGCGCTCTCGTTGGCGCGCCTGCCGGT GGCAGCGCAGCCCAAGGAGGCGGCCGTCCAGAGCGGCGCCGGCGACTACCTGCTGGGCAT CAAGCGGCTGCGGCGGCTCTACTGCAACGTGGGCATCGGCTTCCACCTCCAGGCGCTCCC CGACGGCCGCATCGGCGGCGCGCACGCGGACACCCGCGACAGCCTGCTGGAGCTCTCGCC CGTGGAGCGGGGCGTGGTGAGCATCTTCGGCGTGGCCAGCCGGTTCTTCGTGGCCATGAG CAGCAAGGGCAAGCTCTATGGCTCGCCCTTCTTCACCGATGAGTGCACGTTCAAGGAGAT TCTCCTTCCCAACAACTACAACGCCTACGAGTCCTACAAGTACCCCGGCATGTTCATCGC CCTGAGCAAGAATGGGAAGACCAAGAAGGGGAACCGAGTGTCGCCCACCATGAAGGTCAC CCACTTCCTCCCCAGGCTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_002007 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002007.1, NP_001998.1 |
| RefSeq Size | 1219 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 2249 |
| UniProt ID | P08620 |
| Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway, Transmembrane |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its oncogenic transforming activity. This gene and FGF3, another oncogenic growth factor, are located closely on chromosome 11. Co-amplification of both genes was found in various kinds of human tumors. Studies on the mouse homolog suggested a function in bone morphogenesis and limb development through the sonic hedgehog (SHH) signaling pathway. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Identification of Site-Specific Degradation in Bacterially Expressed Human Fibroblast Growth Factor 4 and Generation of an Aminoterminally Truncated, Stable Form
,Sugawara, S;Ito, T;Sato, S;Sato, Y;Kasuga, K;Kojima, I;Kobayashi, M;,
Appl Biochem Biotechnol. 2013 Sep 26
,PubMed ID 24068478
[FGF4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217058 | FGF4 (Myc-DDK-tagged)-Human fibroblast growth factor 4 (FGF4) |
CNY 2,400.00 |
|
| RC217058L1 | Lenti ORF clone of Human fibroblast growth factor 4 (FGF4), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC217058L2 | Lenti ORF clone of Human fibroblast growth factor 4 (FGF4), mGFP tagged |
CNY 5,890.00 |
|
| RC217058L3 | Lenti ORF clone of Human fibroblast growth factor 4 (FGF4), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217058L4 | Lenti ORF clone of Human fibroblast growth factor 4 (FGF4), mGFP tagged |
CNY 4,800.00 |
|
| RG217058 | FGF4 (tGFP-tagged) - Human fibroblast growth factor 4 (FGF4) |
CNY 4,000.00 |
