HSPB2 (NM_001541) Human Untagged Clone
CAT#: SC303043
HSPB2 (untagged)-Human heat shock 27kDa protein 2 (HSPB2)
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Hs.78846; HSP27; LOH11CR1K; MKBP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303043 representing NM_001541.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGGCCGCTCAGTGCCACATGCCCACCCGGCCACCGCCGAGTACGAATTTGCCAACCCGAGCCGC CTGGGTGAGCAGCGCTTCGGAGAAGGCCTCCTGCCAGAAGAGATCCTGACCCCCACACTCTACCATGGC TACTATGTCCGGCCTCGGGCCGCCCCAGCTGGGGAGGGCAGCAGGGCAGGGGCCTCCGAGCTTAGGCTC AGTGAGGGCAAGTTCCAGGCATTTCTGGATGTGAGCCACTTTACCCCAGACGAGGTGACTGTGAGGACT GTGGATAACCTGCTGGAGGTGTCTGCCCGGCACCCCCAGCGCCTGGACCGCCACGGCTTCGTGTCCCGA GAGTTCTGCCGCACCTATGTCCTGCCTGCTGATGTCGACCCCTGGCGAGTCCGAGCTGCTCTCTCCCAT GATGGCATCTTAAACCTGGAAGCACCTCGGGGTGGCCGACATTTGGACACAGAGGTCAATGAGGTCTAC ATCTCCCTGCTCCCTGCGCCTCCTGATCCAGAGGAAGAGGAGGAGGCAGCCATAGTTGAGCCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001541 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001541.3 |
RefSeq Size | 858 bp |
RefSeq ORF | 549 bp |
Locus ID | 3316 |
UniProt ID | Q16082 |
MW | 20.2 kDa |
Gene Summary | The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The protein is expressed preferentially in the heart and skeletal muscle. This protein regulates Myotonic Dystrophy Protein Kinase, which plays an important role in maintenance of muscle structure and function. [provided by RefSeq, Dec 2012] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Small heat shock proteins target mutant cystic fibrosis transmembrane conductance regulator for degradation via a small ubiquitin-like modifier–dependent pathway
,Annette Ahner, Xiaoyan Gong, Bela Z. Schmidt, Kathryn W. Peters, Wael M. Rabeh, Patrick H. Thibodeau, Gergely L. Lukacs, and Raymond A. Frizzell,
Mol. Biol. Cell, Jan 2013; 24: 74 - 84.
[HSPB2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214718 | HSPB2 (Myc-DDK-tagged)-Human heat shock 27kDa protein 2 (HSPB2) |
CNY 2,400.00 |
|
RC214718L3 | Lenti ORF clone of Human heat shock 27kDa protein 2 (HSPB2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214718L4 | Lenti ORF clone of Human heat shock 27kDa protein 2 (HSPB2), mGFP tagged |
CNY 5,890.00 |
|
RG214718 | HSPB2 (tGFP-tagged) - Human heat shock 27kDa protein 2 (HSPB2) |
CNY 4,000.00 |