Cortistatin (CORT) (NM_001302) Human Untagged Clone
CAT#: SC303001
CORT (untagged)-Human cortistatin (CORT)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CST-14; CST-17; CST-29; SST2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303001 representing NM_001302.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTG GAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTC CTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAA GCCCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCTGCGCGCCGGGACAGAATGCCC TGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302 |
Insert Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302.4 |
RefSeq Size | 1238 bp |
RefSeq ORF | 318 bp |
Locus ID | 1325 |
UniProt ID | O00230 |
Protein Families | Druggable Genome, Secreted Protein |
MW | 11.5 kDa |
Gene Summary | This gene encodes a neuropeptide that is structurally similar to somatostatin. It binds to all known somatostatin receptors, and shares many pharmacological and functional properties with somatostatin, including the depression of neuronal activity. However, it also has many properties distinct from somatostatin, such as induction of slow-wave sleep, apparently by antagonism of the excitatory effects of acetylcholine on the cortex, reduction of locomotor activity, and activation of cation selective currents not responsive to somatostatin. The preproprotein undergoes further processing into multiple mature products. Read-through transcripts exist between this gene and the upstream APITD1 (apoptosis-inducing, TAF9-like domain 1) gene, as represented in GeneID:100526739. [provided by RefSeq, Nov 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222197 | CORT (Myc-DDK-tagged)-Human cortistatin (CORT) |
CNY 1,200.00 |
|
RC222197L3 | Lenti ORF clone of Human cortistatin (CORT), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222197L4 | Lenti ORF clone of Human cortistatin (CORT), mGFP tagged |
CNY 5,890.00 |
|
RG222197 | CORT (tGFP-tagged) - Human cortistatin (CORT) |
CNY 2,800.00 |
其它Cortistatin产品