United States
Germany
Japan
United Kingdom
China
AP1S1 (NM_001283) Human Untagged Clone
CAT＃: SC302999
AP1S1 (untagged)-Human adaptor-related protein complex 1, sigma 1 subunit (AP1S1)
CNY 1,320.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AP19; CLAPS1; EKV3; MEDNIK; SIGMA1A |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001283, the custom clone sequence may differ by one or more nucleotides
ATGATGCGGTTCATGCTATTATTCAGCCGGCAGGGAAAACTGCGGCTGCAAAAATGGTAC CTGGCCACTTCGGACAAGGAACGGAAGAAGATGGTGCGCGAGCTCATGCAGGTTGTCCTG GCTCGAAAGCCCAAGATGTGCAGCTTCCTGGAGTGGAGGGACCTCAAAGTTGTCTATAAG AGATATGCCAGCCTCTACTTCTGCTGCGCCATCGAGGGCCAAGACAATGAGCTCATCACA CTGGAGCTGATCCACCGATACGTGGAGCTCTTAGACAAATACTTTGGCAGTGTGTGCGAG CTGGACATCATCTTCAACTTTGAGAAGGCCTACTTCATCCTGGATGAGTTTTTGATGGGG GGGGATGTCCAGGACACCTCCAAGAAGAGTGTGCTGAAAGCCATCGAGCAGGCTGACCTA CTGCAAGAGGAGGATGAGTCGCCACGGAGTGTGCTGGAGGAGATGGGTTTGGCATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001283 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001283.2, NP_001274.1 |
| RefSeq Size | 614 bp |
| RefSeq ORF | 477 bp |
| Locus ID | 1174 |
| UniProt ID | P61966 |
| Protein Families | Druggable Genome |
| Protein Pathways | Lysosome |
| Gene Summary | The protein encoded by this gene is part of the clathrin coat assembly complex which links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. This protein, as well as beta-prime-adaptin, gamma-adaptin, and the medium (mu) chain AP47, form the AP-1 assembly protein complex located at the Golgi vesicle. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224834 | AP1S1 (Myc-DDK-tagged)-Human adaptor-related protein complex 1, sigma 1 subunit (AP1S1) |
CNY 3,990.00 |
|
| RC224834L3 | Lenti-ORF clone of AP1S1 (Myc-DDK-tagged)-Human adaptor-related protein complex 1, sigma 1 subunit (AP1S1) |
CNY 5,890.00 |
|
| RC224834L4 | Lenti-ORF clone of AP1S1 (mGFP-tagged)-Human adaptor-related protein complex 1, sigma 1 subunit (AP1S1) |
CNY 5,890.00 |
|
| RG224834 | AP1S1 (tGFP-tagged) - Human adaptor-related protein complex 1, sigma 1 subunit (AP1S1) |
CNY 4,370.00 |
