United States
Germany
Japan
United Kingdom
China
DLX1 (NM_001038493) Human Untagged Clone
CAT＃: SC302949
DLX1 (untagged)-Human distal-less homeobox 1 (DLX1), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302949 representing NM_001038493.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCATGACCACCATGCCAGAAAGTCTCAACAGCCCCGTGTCGGGCAAGGCGGTGTTTATGGAGTTT GGGCCGCCCAACCAGCAAATGTCTCCTTCTCCCATGTCCCACGGGCACTACTCCATGCACTGTTTACAC TCGGCGGGCCATTCGCAGCCCGACGGCGCCTACAGCTCAGCCTCGTCCTTCTCCCGACCGCTGGGCTAC CCCTACGTCAACTCGGTCAGCAGCCACGCATCCAGCCCCTACATCAGTTCGGTGCAGTCCTACCCGGGC AGCGCCAGCCTCGCCCAGAGCCGCCTGGAGGACCCAGGTCAAGATCTGGTTCCAAAACAAGCGATCCAA GTTCAAGAAGCTGATGAAGCAGGGTGGGGCGGCTCTGGAGGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001038493 |
| Insert Size | 390 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001038493.1 |
| RefSeq Size | 2203 bp |
| RefSeq ORF | 390 bp |
| Locus ID | 1745 |
| UniProt ID | P56177 |
| Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
| MW | 13.5 kDa |
| Gene Summary | This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. The encoded protein is localized to the nucleus where it may function as a transcriptional regulator of signals from multiple TGF-{beta} superfamily members. The encoded protein may play a role in the control of craniofacial patterning and the differentiation and survival of inhibitory neurons in the forebrain. This gene is located in a tail-to-tail configuration with another member of the family on the long arm of chromosome 2. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an internal exon in the coding region that results in a frameshift and premature stop codon, compared to variant 1. It encodes isoform 2, which has a shorter, distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208797 | DLX1 (Myc-DDK-tagged)-Human distal-less homeobox 1 (DLX1), transcript variant 2 |
CNY 1,200.00 |
|
| RC208797L1 | Lenti ORF clone of Human distal-less homeobox 1 (DLX1), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC208797L2 | Lenti ORF clone of Human distal-less homeobox 1 (DLX1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC208797L3 | Lenti ORF clone of Human distal-less homeobox 1 (DLX1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC208797L4 | Lenti ORF clone of Human distal-less homeobox 1 (DLX1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG208797 | DLX1 (tGFP-tagged) - Human distal-less homeobox 1 (DLX1), transcript variant 2 |
CNY 4,370.00 |
