United States
Germany
Japan
United Kingdom
China
CTLA4 (NM_001037631) Human Untagged Clone
CAT＃: SC302916
CTLA4 (untagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2
CNY 2,400.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALPS5; CD; CD152; CELIAC3; CTLA-4; GRD4; GSE; IDDM12 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001037631 edited
GACCTGAACACCGCTCCCATAAAGCCATGGCTTGCCTTGGATTTCAGCGGCACAAGGCTC AGCTGAACCTGGCTACCAGGACCTGGCCCTGCACTCTCCTGTTTTTTCTTCTCTTCATCC CTGTCTTCTGCAAAGCAATGCACGTGGCCCAGCCTGCTGTGGTACTGGCCAGCAGCCGAG GCATCGCCAGCTTTGTGTGTGAGTATGCATCTCCAGGCAAAGCCACTGAGGTCCGGGTGA CAGTGCTTCGGCAGGCTGACAGCCAGGTGACTGAAGTCTGTGCGGCAACCTACATGATGG GGAATGAGTTGACCTTCCTAGATGATTCCATCTGCACGGGCACCTCCAGTGGAAATCAAG TGAACCTCACTATCCAAGGACTGAGGGCCATGGACACGGGACTCTACATCTGCAAGGTGG AGCTCATGTACCCACCGCCATACTACCTGGGCATAGGCAACGGAACCCAGATTTATGTAA TTGCTAAAGAAAAGAAGCCCTCTTACAACAGGGGTCTATGTGAAAATGCCCCCAACAGAG CCAGAATGTGAAAAGCAATTTCAGCCTTATTTTATTCCCATCAATTGAGAAACCATTATG AAGAAGAGAGTCCATATTTCAATTTCCAAGAGCTGAGG |
| Restriction Sites | Please inquire |
| ACCN | NM_001037631 |
| Insert Size | 750 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to the reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001037631.1, NP_001032720.1 |
| RefSeq Size | 1878 bp |
| RefSeq ORF | 525 bp |
| Locus ID | 1493 |
| UniProt ID | P16410 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Autoimmune thyroid disease, Cell adhesion molecules (CAMs), T cell receptor signaling pathway |
| Gene Summary | This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform CTLA-4delTM (also known as sCTLA4) is soluble and lacks the transmembrane domain, compared to isoform a. The exon skip represented in this variant is is based on human U90273.1, and is consistent with mouse U90270.1 and the data published in PMID:10831323 and PMID:10556814. CCDS Note: This CCDS representation is based on U90273.1 and on full-length RT-PCR evidence from PMIDs 10831323 and 10556814. This variant also has homology support from cow AF539438.1, mouse U90270.1 and rat U90271.1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Leukemic B Cell CTLA-4 Suppresses Co-stimulation of T cells
,null,
Journal of immunology (Baltimore, Md. : 1950)
,PubMed ID 30910862
[CTLA4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213631 | CTLA4 (Myc-DDK-tagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2 |
CNY 3,600.00 |
|
| RC213631L1 | Lenti ORF clone of Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC213631L2 | Lenti ORF clone of Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2, mGFP tagged |
CNY 6,000.00 |
|
| RC213631L3 | Lenti ORF clone of Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC213631L4 | Lenti ORF clone of Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2, mGFP tagged |
CNY 6,000.00 |
|
| RG213631 | CTLA4 (tGFP-tagged) - Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2 |
CNY 5,200.00 |
