PHYH (NM_001037537) Human Untagged Clone

CAT#: SC302910

PHYH (untagged)-Human phytanoyl-CoA 2-hydroxylase (PHYH), transcript variant 2



  "NM_001037537" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PHYH Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LN1; LNAP1; PAHX; PHYH1; RD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302910 representing NM_001037537.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGAGATGTGACCATTTCGAAATCCGAATATGCTCCAAGTGAGAAGATGATCACGAAGGTCCAGGAT
TTCCAGGAAGATAAGGAGCTCTTCAGATACTGCACTCTCCCCGAGATTCTGAAATATGTGGAGTGCTTC
ACTGGACCTAATATTATGGCCATGCACACAATGTTGATAAACAAACCTCCAGATTCTGGCAAGAAGACG
TCCCGTCACCCCCTGCACCAGGACCTGCACTATTTCCCCTTCAGGCCCAGCGATCTCATCGTTTGCGCC
TGGACGGCGATGGAGCACATCAGCCGGAACAACGGCTGTCTGGTTGTGCTCCCAGGCACACACAAGGGC
TCCCTGAAGCCCCACGATTACCCCAAGTGGGAGGGGGGAGTTAACAAAATGTTCCACGGGATCCAGGAC
TACGAGGAAAACAAGGCCCGGGTGCACCTGGTGATGGAGAAGGGCGACACTGTTTTCTTCCATCCTTTG
CTCATCCACGGATCTGGTCAGAATAAAACCCAGGGATTCCGGAAGGCAATTTCCTGCCATTTCGCCAGT
GCCGATTGCCACTACATTGACGTGAAGGGCACCAGTCAAGAAAACATCGAGAAGGAAGTTGTAGGAATA
GCACATAAATTCTTTGGAGCTGAAAATAGCGTGAACTTGAAGGATATTTGGATGTTTCGAGCTCGACTT
GTGAAAGGAGAAAGAACCAATCTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001037537
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001037537.1
RefSeq Size 1725 bp
RefSeq ORF 717 bp
Locus ID 5264
UniProt ID O14832
Protein Families Druggable Genome
MW 27.3 kDa
Gene Summary This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream ATG and result in an isoform (b) with a shorter N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...