DEFB124 (NM_001037500) Human Untagged Clone
CAT#: SC302904
DEFB124 (untagged)-Human defensin, beta 124 (DEFB124)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEFB-24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302904 representing NM_001037500.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACACAGCTGCTTCTGTTCCTTGTGGCTCTCCTGGTTCTGGGTCATGTGCCATCAGGGAGAAGTGAA TTCAAACGGTGCTGGAAGGGTCAAGGGGCCTGCCAAACTTACTGCACAAGGCAAGAAACTTACATGCAC CTGTGCCCGGATGCGTCCCTGTGCTGTCTCTCCTATGCATTGAAACCTCCACCGGTCCCCAAGCATGAA TATGAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037500 |
Insert Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037500.1 |
RefSeq Size | 216 bp |
RefSeq ORF | 216 bp |
Locus ID | 245937 |
UniProt ID | Q8NES8 |
Protein Families | Secreted Protein |
MW | 8.1 kDa |
Gene Summary | Defensins are cysteine-rich cationic polypeptides that are important in the host immunologic response to invading microorganisms. This antimicrobial protein is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20q11.1. The encoded protein may serve to enhance innate immunity in the prostate. [provided by RefSeq, Nov 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217724 | DEFB124 (Myc-DDK-tagged)-Human defensin, beta 124 (DEFB124) |
CNY 1,200.00 |
|
RC217724L1 | Lenti ORF clone of Human defensin, beta 124 (DEFB124), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC217724L2 | Lenti ORF clone of Human defensin, beta 124 (DEFB124), mGFP tagged |
CNY 5,890.00 |
|
RC217724L3 | Lenti ORF clone of Human defensin, beta 124 (DEFB124), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217724L4 | Lenti ORF clone of Human defensin, beta 124 (DEFB124), mGFP tagged |
CNY 5,890.00 |
|
RG217724 | DEFB124 (tGFP-tagged) - Human defensin, beta 124 (DEFB124) |
CNY 4,370.00 |
其它DEFB124产品