United States
Germany
Japan
United Kingdom
China
SDHC (NM_001035511) Human Untagged Clone
CAT＃: SC302837
SDHC (untagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CYB560; CYBL; PGL3; QPS1; SDH3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001035511 edited
ATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATTGCCTCCGAGCCCACTTTAGCCCT CAGCTCTGTATCAGAAATGCTGTTCCTTTGGGAACCACGGCCAAAGAAGAGATGGAGCGG TTCTGGAATAAGAATATAGGTTCAAACCGTCCTCTGTCTCCCCACATTACTATCTACAGT TGGTCTCTTCCCATGGCGATGTCCATCTGCCACCGTGGCACTGGTATTGCTTTGAGTGCA GATGTGGGACCTAGGAAAAGGCCTGAAGATTCCCCAGCTATACCAGTCTGGAGTGGTTGT CCTGGTTCTTACTGTGTTGTCCTCTATGGGGCTGGCAGCCATGTGAAGAAAGGAGGCTCC CAGCATCATCTTCCTACACATTATTACATTCACCCATCTTTCTGTTTGTCATTCTTATCT CCAGCCTGGGAAAAGTTCTCCTTATTTGTTTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001035511 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001035511.1, NP_001030588.1 |
| RefSeq Size | 2694 bp |
| RefSeq ORF | 453 bp |
| Locus ID | 6391 |
| UniProt ID | Q99643 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
| Gene Summary | This gene encodes one of four nuclear-encoded subunits that comprise succinate dehydrogenase, also known as mitochondrial complex II, a key enzyme complex of the tricarboxylic acid cycle and aerobic respiratory chains of mitochondria. The encoded protein is one of two integral membrane proteins that anchor other subunits of the complex, which form the catalytic core, to the inner mitochondrial membrane. There are several related pseudogenes for this gene on different chromosomes. Mutations in this gene have been associated with paragangliomas. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2013] Transcript Variant: This variant (2, also known as delta5) lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212745 | SDHC (Myc-DDK-tagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
| RC212745L3 | Lenti-ORF clone of SDHC (Myc-DDK-tagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RC212745L4 | Lenti-ORF clone of SDHC (mGFP-tagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RG212745 | SDHC (tGFP-tagged) - Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |
