UFD1 (NM_001035247) Human Untagged Clone

CAT#: SC302828

UFD1L (untagged)-Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2



  "NM_001035247" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
UFD1L mouse monoclonal antibody, clone OTI8G6 (formerly 8G6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UFD1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302828 representing NM_001035247.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCTCTTTCAACATGTTCGACCACCCTATTCCCAGGGTCTTCCAAAACCGCTTCTCCACACAGTAC
CGCTGCTTCTCTGTGTCCATGCTAGCAGGGCCTAATGACAGGTCAGATGTGGAGAAAGGAGGGAAGATA
ATTATGCCACCCTCGGCCCTGGACCAACTCAGCCGACTTAACATTACCTATCCCATGCTGTTCAAACTG
ACCAATAAGAATTCGGACCGCATGACGCATTGTGGCGTGCTGGAGTTTGTGGCTGATGAGGGCATCTGC
TACCTCCCACACTGGATGATGCAGAACTTACTCTTGGAAGAAGGCGGCCTGGTCCAGGTGGAGAGCGTC
AACCTTCAAGTGGCCACCTACTCCAAATTCCAACCTCAGAGCCCTGACTTCCTGGACATCACCAACCCC
AAAGCCGTATTAGAAAACGCACTTAGGAACTTTGCCTGTCTGACCACCGGGGATGTGATTGCCATCAAC
TATAATGAAAAGATCTACGAACTGCGTGTGATGGAGACCAAACCCGACAAGGCAGTGTCCATCATTGAG
TGTGACATGAACGTGGACTTTGATGCTCCCCTGGGCTACAAAGAACCCGAAAGACAAGTCCAGCATGAG
GAGTCGACAGAAGGTGAAGCCGACCACAGTGGCTATGCTGGAGAGCTGGGCTTCCGCGCTTTCTCTGGA
TCTGGCAATAGACTGGATGGAAAGAAGAAAGGGGTAGAGCCCAGCCCCTCCCCAATCAAGCCTGGAGAT
ATTAAAAGAGGAATTCCCAATTATGAATTTAAACTTGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001035247
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001035247.2
RefSeq Size 1730 bp
RefSeq ORF 801 bp
Locus ID 7353
UniProt ID Q92890
MW 29.9 kDa
Gene Summary The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 1. The encoded isoform (B) has a distinct C-terminus and is shorter than isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...