UFD1 (NM_001035247) Human Untagged Clone
CAT#: SC302828
UFD1L (untagged)-Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UFD1L |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302828 representing NM_001035247.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCTCTTTCAACATGTTCGACCACCCTATTCCCAGGGTCTTCCAAAACCGCTTCTCCACACAGTAC CGCTGCTTCTCTGTGTCCATGCTAGCAGGGCCTAATGACAGGTCAGATGTGGAGAAAGGAGGGAAGATA ATTATGCCACCCTCGGCCCTGGACCAACTCAGCCGACTTAACATTACCTATCCCATGCTGTTCAAACTG ACCAATAAGAATTCGGACCGCATGACGCATTGTGGCGTGCTGGAGTTTGTGGCTGATGAGGGCATCTGC TACCTCCCACACTGGATGATGCAGAACTTACTCTTGGAAGAAGGCGGCCTGGTCCAGGTGGAGAGCGTC AACCTTCAAGTGGCCACCTACTCCAAATTCCAACCTCAGAGCCCTGACTTCCTGGACATCACCAACCCC AAAGCCGTATTAGAAAACGCACTTAGGAACTTTGCCTGTCTGACCACCGGGGATGTGATTGCCATCAAC TATAATGAAAAGATCTACGAACTGCGTGTGATGGAGACCAAACCCGACAAGGCAGTGTCCATCATTGAG TGTGACATGAACGTGGACTTTGATGCTCCCCTGGGCTACAAAGAACCCGAAAGACAAGTCCAGCATGAG GAGTCGACAGAAGGTGAAGCCGACCACAGTGGCTATGCTGGAGAGCTGGGCTTCCGCGCTTTCTCTGGA TCTGGCAATAGACTGGATGGAAAGAAGAAAGGGGTAGAGCCCAGCCCCTCCCCAATCAAGCCTGGAGAT ATTAAAAGAGGAATTCCCAATTATGAATTTAAACTTGGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001035247 |
Insert Size | 801 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001035247.2 |
RefSeq Size | 1730 bp |
RefSeq ORF | 801 bp |
Locus ID | 7353 |
UniProt ID | Q92890 |
MW | 29.9 kDa |
Gene Summary | The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 1. The encoded isoform (B) has a distinct C-terminus and is shorter than isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213180 | UFD1L (Myc-DDK-tagged)-Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2 |
CNY 2,400.00 |
|
RC213180L3 | Lenti ORF clone of Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213180L4 | Lenti ORF clone of Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG213180 | UFD1L (tGFP-tagged) - Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2 |
CNY 4,000.00 |