United States
Germany
Japan
United Kingdom
China
NHP2 (NM_001034833) Human Untagged Clone
CAT＃: SC302797
NHP2 (untagged)-Human NHP2 ribonucleoprotein homolog (yeast) (NHP2), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DKCB2; NHP2P; NOLA2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001034833, the custom clone sequence may differ by one or more nucleotides
ATGACCAAAATAAAGGCAGATCCCGACGGGCCCGAGGCTCAGGCGGAGGCGTGTTCCGGG GAGCGCACCTACCAGGAGCTGCTGGTCAACCAGAACCCCATCGCGCAGCCCCTGGCTTCT CGCCGCCTCACGCGGAAGCTCTACAAATGCATCAAGAAAGCGGTGAAGCAGAAGCAGATT CGGCGCGGGGTGAAAGAGGTTCAGAAATTTGTCAACAAAGGAGAAAAAGGGACCTGGGTG CAGCCGCAGGCTCCAAGCGCCCCACCTGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001034833 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001034833.1, NP_001030005.1 |
| RefSeq Size | 761 bp |
| RefSeq ORF | 273 bp |
| Locus ID | 55651 |
| UniProt ID | Q9NX24 |
| Gene Summary | This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting protein (isoform b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223944 | NHP2 (Myc-DDK-tagged)-Human NHP2 ribonucleoprotein homolog (yeast) (NHP2), transcript variant 2 |
CNY 3,990.00 |
|
| RC223944L3 | Lenti-ORF clone of NHP2 (Myc-DDK-tagged)-Human NHP2 ribonucleoprotein homolog (yeast) (NHP2), transcript variant 2 |
CNY 5,890.00 |
|
| RC223944L4 | Lenti-ORF clone of NHP2 (mGFP-tagged)-Human NHP2 ribonucleoprotein homolog (yeast) (NHP2), transcript variant 2 |
CNY 5,890.00 |
|
| RG223944 | NHP2 (tGFP-tagged) - Human NHP2 ribonucleoprotein homolog (yeast) (NHP2), transcript variant 2 |
CNY 4,370.00 |
