PKC zeta (PRKCZ) (NM_001033582) Human Untagged Clone

CAT#: SC302749

PRKCZ (untagged)-Human protein kinase C, zeta (PRKCZ), transcript variant 3



  "NM_001033582" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit polyclonal PKC zeta (Thr410) antibody(Phospho-specific)
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PKC-ZETA; PKC2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302749 representing NM_001033582.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATTCTGTCATGCCTTCCCAAGAGCCTCCAGTAGACGACAAGAACGAGGACGCCGACCTTCCTTCC
GAGGAGACAGATGGAATTGCTTACATTTCCTCATCCCGGAAGCATGACAGCATTAAAGACGACTCGGAG
GACCTTAAGCCAGTTATCGATGGGATGGATGGAATCAAAATCTCTCAGGGGCTTGGGCTGCAGGACTTT
GACCTAATCAGAGTCATCGGGCGCGGGAGCTACGCCAAGGTTCTCCTGGTGCGGTTGAAGAAGAATGAC
CAAATTTACGCCATGAAAGTGGTGAAGAAAGAGCTGGTGCATGATGACGAGGATATTGACTGGGTACAG
ACAGAGAAGCACGTGTTTGAGCAGGCATCCAGCAACCCCTTCCTGGTCGGATTACACTCCTGCTTCCAG
ACGACAAGTCGGTTGTTCCTGGTCATTGAGTACGTCAACGGCGGGGACCTGATGTTCCACATGCAGAGG
CAGAGGAAGCTCCCTGAGGAGCACGCCAGGTTCTACGCGGCCGAGATCTGCATCGCCCTCAACTTCCTG
CACGAGAGGGGGATCATCTACAGGGACCTGAAGCTGGACAACGTCCTCCTGGATGCGGACGGGCACATC
AAGCTCACAGACTACGGCATGTGCAAGGAAGGCCTGGGCCCTGGTGACACAACGAGCACTTTCTGCGGA
ACCCCGAATTACATCGCCCCCGAAATCCTGCGGGGAGAGGAGTACGGGTTCAGCGTGGACTGGTGGGCG
CTGGGAGTCCTCATGTTTGAGATGATGGCCGGGCGCTCCCCGTTCGACATCATCACCGACAACCCGGAC
ATGAACACAGAGGACTACCTTTTCCAAGTGATCCTGGAGAAGCCCATCCGGATCCCCCGGTTCCTGTCC
GTCAAAGCCTCCCATGTTTTAAAAGGATTTTTAAATAAGGACCCCAAAGAGAGGCTCGGCTGCCGGCCA
CAGACTGGATTTTCTGACATCAAGTCCCACGCGTTCTTCCGCAGCATAGACTGGGACTTGCTGGAGAAG
AAGCAGGCGCTCCCTCCATTCCAGCCACAGATCACAGACGACTACGGTCTGGACAACTTTGACACACAG
TTCACCAGCGAGCCCGTGCAGCTGACCCCAGACGATGAGGATGCCATAAAGAGGATCGACCAGTCAGAG
TTCGAAGGCTTTGAGTATATCAACCCATTATTGCTGTCCACCGAGGAGTCGGTGTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001033582
Insert Size 1230 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001033582.1
RefSeq Size 2044 bp
RefSeq ORF 1230 bp
Locus ID 5590
UniProt ID Q05513
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Chemokine signaling pathway, Endocytosis, Insulin signaling pathway, Tight junction, Type II diabetes mellitus
MW 46.6 kDa
Gene Summary Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation from a downstream ATG and an isoform (3) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...