PAIP2 (NM_001033112) Human Untagged Clone
CAT#: SC302702
PAIP2 (untagged)-Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PAIP-2; PAIP2A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302702 representing NM_001033112.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAGATCCAAGTCGCAGCAGTACTAGCCCAAGCATCATCAATGAAGATGTGATTATTAACGGTCAT TCTCATGAAGATGACAATCCATTTGCAGAGTACATGTGGATGGAAAATGAAGAAGAATTCAACAGACAA ATAGAAGAGGAGTTATGGGAAGAAGAATTTATTGAACGCTGTTTCCAAGAAATGCTGGAAGAGGAAGAA GAGCATGAATGGTTTATTCCAGCTCGAGATCTCCCACAAACTATGGACCAAATCCAAGACCAGTTTAAT GACCTTGTTATCAGTGATGGCTCTTCTCTGGAAGATCTTGTGGTCAAGAGCAATCTGAATCCAAATGCA AAGGAGTTTGTTCCTGGGGTGAAGTACGGAAATATTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033112 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033112.2 |
RefSeq Size | 1532 bp |
RefSeq ORF | 384 bp |
Locus ID | 51247 |
UniProt ID | Q9BPZ3 |
MW | 15 kDa |
Gene Summary | Acts as a repressor in the regulation of translation initiation of poly(A)-containing mRNAs. Its inhibitory activity on translation is mediated via its action on PABPC1. Displaces the interaction of PABPC1 with poly(A) RNA and competes with PAIP1 for binding to PABPC1. Its association with PABPC1 results in disruption of the cytoplasmic poly(A) RNP structure organization.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the functional protein. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213229 | PAIP2 (Myc-DDK-tagged)-Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1 |
CNY 1,200.00 |
|
RC213229L1 | Lenti ORF clone of Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC213229L2 | Lenti ORF clone of Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC213229L3 | Lenti ORF clone of Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC213229L4 | Lenti ORF clone of Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1, mGFP tagged |
CNY 3,600.00 |
|
RG213229 | PAIP2 (tGFP-tagged) - Human poly(A) binding protein interacting protein 2 (PAIP2), transcript variant 1 |
CNY 2,800.00 |