PQBP1 (NM_001032384) Human Untagged Clone
CAT#: SC302649
PQBP1 (untagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001032384, the custom clone sequence may differ by one or more nucleotides
ATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTG GAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTAC GAGGCCACCAGGTTGGAGGGCCTACCACCAAGCTGGTACAAGGTGTTCGACCCTTCCTGC GGGCTCCCTTACTACTGGAATGCAGACACAGACCTTGTATCCTGGCTCTCCCCACATGAC CCCAACTCCGTGGTTACCAAATCGGCCAAGAAGCTCAGAAGCAGTAATGCAGATGCTGAA GAAAAGTTGGACCGGAGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGGACCGCAGC CATGAGAAACTAGACAGGGGCCACGACAAGTCAGACCGGGGCCACGACAAGTCTGACAGG GATCGAGAGCGTGGCTATGACAAGGTAGACAGAGAGAGAGAGCGAGACAGGGAACGGGAT CGGGACCGCGGGTATGACAAGGCAGACCGGGAAGAGGGCAAAGAACGGCGCCACCATCGC CGGGAGGAGCTGGCTCCCTATCCCAAGAGCAAGAAGGCAGTAAGCCGAAAGGATGAAGAG TTAGACCCCATGGACCCTAGCTCATACTCAGACGCCCCCCGGGGCACGTGGTCAACAGGA CTCCCCAAGCGGAATGAGGCCAAGACTGGCGCTGACACCACAGCAGCTGGGCCCCTCTTC CAGCAGCGGCCGTATCCATCCCCAGGGGCTGTGCTCCGGGCCAATGCAGAGGCCTCCCGA ACCAAGCAGCAGGATTGA |
Restriction Sites | Please inquire |
ACCN | NM_001032384 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001032384.1, NP_001027556.1 |
RefSeq Size | 1002 bp |
RefSeq ORF | 798 bp |
Locus ID | 10084 |
UniProt ID | O60828 |
Protein Families | Transcription Factors |
Protein Pathways | Spliceosome |
Gene Summary | This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221161 | PQBP1 (Myc-DDK-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 |
CNY 2,400.00 |
|
RC221161L3 | Lenti-ORF clone of PQBP1 (Myc-DDK-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 |
CNY 5,890.00 |
|
RC221161L4 | Lenti-ORF clone of PQBP1 (mGFP-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 |
CNY 5,890.00 |
|
RG221161 | PQBP1 (tGFP-tagged) - Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 |
CNY 4,370.00 |