MST3 (STK24) (NM_001032296) Human Untagged Clone

CAT#: SC302633

STK24 (untagged)-Human serine/threonine kinase 24 (STK24), transcript variant 2



  "NM_001032296" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
STK24 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-95; MST3; MST3B; STE20; STK3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001032296 edited
ATGGCTCACTCCCCGGTGCAGTCGGGCCTGCCCGGCATGCAGAACCTAAAGGCAGACCCA
GAAGAGCTTTTTACAAAACTAGAGAAAATTGGGAAGGGCTCCTTTGGAGAGGTGTTCAAA
GGCATTGACAATCGGACTCAGAAAGTGGTTGCCATAAAGATCATTGATCTGGAAGAAGCT
GAAGATGAGATAGAGGACATTCAACAAGAAATCACAGTGCTGAGTCAGTGTGACAGTCCA
TATGTAACCAAATATTATGGATCCTATCTGAAGGATACAAAATTATGGATAATAATGGAA
TATCTTGGTGGAGGCTCCGCACTAGATCTATTAGAACCTGGCCCATTAGATGAAACCCAG
ATCGCTACTATATTAAGAGAAATACTGAAAGGACTCGATTATCTCCATTCGGAGAAGAAA
ATCCACAGAGACATTAAAGCGGCCAACGTCCTGCTGTCTGAGCATGGCGAGGTGAAGCTG
GCGGACTTTGGCGTGGCTGGCCAGCTGACAGACACCCAGATCAAAAGGAACACCTTCGTG
GGCACCCCATTCTGGATGGCACCCGAGGTCATCAAACAGTTGGCCTATGACTCGAAGGCA
GACATCTGGTCCCTGGGCATAACAGCTATTGAACTTGCAAGAGGGGAACCACCTCATTCC
GAGCTGCACCCCATGAAAGTTTTATTCCTCATTCCAAAGAACAACCCACCGACGTTGGAA
GGAAACTACAGTAAACCCCTCAAGGAGTTTGTGGAGGCCTGTTTGAATAAGGAGCCGAGC
TTTAGACCCACTGCTAAGGAGTTATTGAAGCACAAGTTTATACTACGCAATGCAAAGAAA
ACTTCCTACTTGACCGAGCTCATCGACAGGTACAAGAGATGGAAGGCCGAGCAGAGCCAT
GACGACTCGAGCTCCGAGGATTCCGACGCGGAAACAGATGGCCAAGCCTCGGGGGGCAGT
GATTCTGGGGACTGGATCTTCACAATCCGAGAAAAAGATCCCAAGAATCTCGAGAATGGA
GCTCTTCAGCCATCGGACTTGGACAGAAATAAGATGAAAGACATCCCAAAGAGGCCTTTC
TCTCAGTGTTTATCTACAATTATTTCTCCTCTGTTTGCAGAGTTGAAGGAGAAGAGCCAG
GCGTGCGGAGGGAACTTGGGGTCCATTGAAGAGCTGCGAGGGGCCATCTACCTAGCGGAG
GAGGCGTGCCCTGGCATCTCCGACACCATGGTGGCCCAGCTCGTGCAGCGGCTCCAGAGA
TACTCTCTAAGTGGTGGAGGAACTTCATCCCACTGA
Restriction Sites Please inquire     
ACCN NM_001032296
Insert Size 2400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001032296.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001032296.1, NP_001027467.1
RefSeq Size 2636 bp
RefSeq ORF 1296 bp
Locus ID 8428
UniProt ID Q9Y6E0
Protein Families Druggable Genome, Protein Kinase
Gene Summary This gene encodes a serine/threonine protein kinase that functions upstream of mitogen-activated protein kinase (MAPK) signaling. The encoded protein is cleaved into two chains by caspases; the N-terminal fragment (MST3/N) translocates to the nucleus and promotes programmed cells death. There is a pseudogene for this gene on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...