RCE1 (NM_001032279) Human Untagged Clone
CAT#: SC302619
RCE1 (untagged)-Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FACE2; RCE1A; RCE1B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302619 representing NM_001032279.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCTTCAGGCTGGAGGGCATTTTCCCAGCGGCGCTGCTGCCCCTGTTGCTGACCATGATTCTTTTC CTGGGCCCACTGATGCAGCTCTCTATGGATTGCCCTTGTGACCTGGCAGATGGGCTGAAGGTTGTCCTG GCCCCCCGCTCCTGGGCCCGCTGCCTCACAGACATGCGTTGGCTGCGGAACCAAGTGATCGCCCCGCTG ACAGAGGAGCTGGTGTTCCGGGCCTGTATGCTGCCCATGTTAGCACCGTGCATGGGCCTGGGCCCTGCT GTGTTCACCTGCCCGCTCTTTTTTGGAGTTGCCCATTTTCACCATATTATTGAGCAGCTGCGTTTCCGC CAGAGCAGCGTGGGGAACATCTTCTTGTCTGCTGCGTTCCAGTTCTCCTACACAGCTGTCTTCGGTGCC TACACTGCTTTCCTCTTCATCCGCACAGGACACCTGATTGGGCCGGTTCTCTGCCATTCCTTCTGCAAT TACATGGGTTTCCCAGCTGTTTGCGCGGCCTTGGAGCACCCACAGAGGCGGCCCCTGCTGGCAGGCTAT GCCCTGGGTGTGGGACTCTTCCTGCTTCTGCTCCAGCCCCTCACGGACCCCAAGCTCTACGGCAGCCTT CCCCTTTGTGTGCTTTTGGAGCGGGCAGGGGACTCAGAGGCTCCCCTGTGCTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001032279 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001032279.1 |
RefSeq Size | 1485 bp |
RefSeq ORF | 678 bp |
Locus ID | 9986 |
UniProt ID | Q9Y256 |
Protein Families | Protease, Transmembrane |
MW | 24.8 kDa |
Gene Summary | This gene encodes an integral membrane protein which is classified as a member of the metalloproteinase family. This enzyme is thought to function in the maintenance and processing of CAAX-type prenylated proteins. [provided by RefSeq, Jul 2008] Transcript Variant: This variant uses an alternate splice site in the 5' coding region, compared to variant 1. This difference results in translation initiation at a downstream ATG and an isoform (2) with a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210814 | RCE1 (Myc-DDK-tagged)-Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2 |
CNY 2,400.00 |
|
RC210814L1 | Lenti ORF clone of Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210814L2 | Lenti ORF clone of Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC210814L3 | Lenti ORF clone of Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210814L4 | Lenti ORF clone of Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG210814 | RCE1 (tGFP-tagged) - Human RCE1 homolog, prenyl protein peptidase (S. cerevisiae) (RCE1), transcript variant 2 |
CNY 4,370.00 |