MASP1 (NM_001031849) Human Untagged Clone
CAT#: SC302611
MASP1 (untagged)-Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 3
CNY 3,656.00
CNY 6,180.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 3MC1; CRARF; CRARF1; MAP-1; MAP1; MAp44; MASP; MASP-3; MASP3; PRSS5; RaRF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001031849 edited
ATGAGGTGGCTGCTTCTCTATTATGCTCTGTGCTTCTCCCTGTCAAAGGCTTCAGCCCAC ACCGTGGAGCTAAACAATATGTTTGGCCAGATCCAGTCGCCTGGTTATCCAGACTCCTAT CCCAGTGATTCAGAGGTGACTTGGAATATCACTGTCCCAGATGGGTTTCGGATCAAGCTT TACTTCATGCACTTCAACTTGGAATCCTCCTACCTTTGTGAATATGACTATGTGAAGGTA GAAACTGAGGACCAGGTGCTGGCAACCTTCTGTGGCAGGGAGACCACAGACACAGAGCAG ACTCCCGGCCAGGAGGTGGTCCTCTCCCCTGGCTCCTTCATGTCCATCACTTTCCGGTCA GATTTCTCCAATGAGGAGCGTTTCACAGGCTTTGATGCCCACTACATGGCTGTGGATGTG GACGAGTGCAAGGAGAGGGAGGACGAGGAGCTGTCCTGTGACCACTACTGCCACAACTAC ATTGGCGGCTACTACTGCTCCTGCCGCTTCGGCTACATCCTCCACACAGACAACAGGACC TGCCGAGTGGAGTGCAGTGACAACCTCTTCACTCAAAGGACTGGGGTGATCACCAGCCCT GACTTCCCAAACCCTTACCCCAAGAGCTCTGAATGCCTGTATACCATCGAGCTGGAGGAG GGTTTCATGGTCAACCTGCAGTTTGAGGACATATTTGACATTGAGGACCATCCTGAGGTG CCCTGCCCCTATGACTACATCAAGATCAAAGTTGGTCCAAAAGTTTTGGGGCCTTTCTGT GGAGAGAAAGCCCCAGAACCCATCAGCACCCAGAGCCACAGTGTCCTGATCCTGTTCCAT AGTGACAACTCGGGAGAGAACCGGGGCTGGAGGCTCTCATACAGGGCTGCAGGAAATGAG TGCCCAGAGCTACAGCCTCCTGTCCATGGGAAAATCGAGCCCTCCCAAGCCAAGTATTTC TTCAAAGACCAAGTGCTCGTCAGCTGTGACACAGGCTACAAAGTGCTGAAGGATAATGTG GAGATGGACACATTCCAGATTGAGTGTCTGAAGGATGGGACGTGGAGTAACAAGATTCCC ACCTGTAAAAAAAATGAAATCGATCTGGAGAGCGAACTCAAGTCAGAGCAAGTGACAGAG TGA |
Restriction Sites | Please inquire |
ACCN | NM_001031849 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001031849.1, NP_001027019.1 |
RefSeq Size | 2072 bp |
RefSeq ORF | 1143 bp |
Locus ID | 5648 |
UniProt ID | P48740 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010] Transcript Variant: This variant (3) differs in the 3' UTR and 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. This isoform (3) is referred to as MAp44 or MAP1 in the literature. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217417 | MASP1 (Myc-DDK-tagged)-Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 3 |
CNY 3,656.00 |
|
RC217417L3 | Lenti-ORF clone of MASP1 (Myc-DDK-tagged)-Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 3 |
CNY 5,890.00 |
|
RC217417L4 | Lenti-ORF clone of MASP1 (mGFP-tagged)-Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 3 |
CNY 5,890.00 |
|
RG217417 | MASP1 (tGFP-tagged) - Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 3 |
CNY 4,370.00 |