SFRS7 (SRSF7) (NM_001031684) Human Untagged Clone
CAT#: SC302531
SRSF7 (untagged)-Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 9G8; AAG3; SFRS7 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001031684 edited
ATGTCGCGTTACGGGCGGTACGGAGGAGAAACCAAGGTGTATGTTGGTAACCTGGGAACT GGCGCTGGCAAAGGAGAGTTAGAAAGGGCTTTCAGTTATTATGGTCCTTTAAGAACTGTA TGGATTGCGAGAAATCCTCCAGGATTTGCCTTTGTGGAATTCGAAGATCCTAGAGATGCA GAAGATGCAGTACGAGGACTGGATGGAAAGGTGATTTGTGGCTCCCGAGTGAGGGTTGAA CTATCGACAGGCATGCCTCGGAGATCACGTTTTGATAGACCACCTGCCCGACGTCCCTTT GATCCAAATGATAGATGCTATGAGTGTGGCGAAAAGGGACATTATGCTTATGATTGTCAT CGTTACAGCCGGCGAAGAAGAAGCAGGTCACGGTCTAGATCACATTCTCGATCCAGAGGA AGGCGATACTCTCGCTCACGCAGCAGGAGCAGGGGACGAAGGTCAAGGTCAGCATCTCCT CGACGATCAAGATCTATCTCTCTTCGTAGATCAAGATCAGCTTCACTCAGAAGATCTAGG TCTGGTTCTATAAAAGGATCGAGGTATTTCCAATCCCCGTCGAGGTCAAGATCAAGATCC AGGTCTATTTCACGACCAAGAAGCAGCCGATCAAAGTCCAGATCTCCATCTCCAAAAAGA AGTCGTTCCCCATCAGGAAGTCCTCGCAGAAGTGCAAGTCCTGAAAGAATGGACTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001031684 |
Insert Size | 2700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001031684.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001031684.1, NP_001026854.1 |
RefSeq Size | 2381 bp |
RefSeq ORF | 717 bp |
Locus ID | 6432 |
UniProt ID | Q16629 |
Protein Pathways | Spliceosome |
Gene Summary | The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an N-terminal RNA recognition motif (RRM) for binding RNA and a C-terminal RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2018] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204785 | SRSF7 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1 |
CNY 2,400.00 |
|
RC204785L1 | Lenti ORF clone of Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC204785L2 | Lenti ORF clone of Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC204785L3 | Lenti ORF clone of Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204785L4 | Lenti ORF clone of Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG204785 | SRSF7 (tGFP-tagged) - Human serine/arginine-rich splicing factor 7 (SRSF7), transcript variant 1 |
CNY 4,000.00 |