CPLX3 (NM_001030005) Human Untagged Clone

CAT#: SC302487

CPLX3 (untagged)-Human complexin 3 (CPLX3)



  "NM_001030005" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CPLX3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPX-III; CPXIII; Nbla11589
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302487 representing NM_001030005.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTTCATGGTGAAGACCATGGTGGGCGGCCAGCTGAAGAACCTCACTGGGAGCCTGGGAGGCGGC
GAGGATAAGGGAGATGGGGACAAGTCGGCAGCCGAAGCTCAGGGCATGAGCCGGGAGGAGTACGAGGAG
TATCAGAAGCAACTCGTGGAAGAGAAGATGGAGCGGGATGCACAGTTCACACAGAGGAAGGCAGAGCGG
GCCACACTGCGGAGCCACTTCCGAGACAAATACCGGCTACCCAAGAACGAGACAGATGAGAGCCAGATC
CAGATGGCAGGTGGAGACGTGGAGCTGCCCCGGGAGCTGGCCAAGATGATCGAGGAGGACACAGAGGAG
GAGGAGGAGAAGGCCTCAGTCCTTGGGCAGCTGGCCAGCCTTCCTGGCTTGAACCTGGGCTCACTCAAG
GACAAGGCCCAGGCCACACTGGGGGATCTCAAGCAATCAGCTGAGAAGTGTCACGTCATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001030005
Insert Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001030005.2
RefSeq Size 2012 bp
RefSeq ORF 477 bp
Locus ID 594855
UniProt ID Q8WVH0
MW 17.6 kDa
Gene Summary Complexin that regulates SNARE protein complex-mediated synaptic vesicle fusion (By similarity). Required for the maintenance of synaptic ultrastructure in the adult retina (By similarity). Positively regulates synaptic transmission through synaptic vesicle availability and exocytosis of neurotransmitters at photoreceptor ribbon synapses in the retina (By similarity). Suppresses tonic photoreceptor activity and baseline 'noise' by suppression of Ca(2+) vesicle tonic release and the facilitation of evoked synchronous and asynchronous Ca(2+) vesicle release (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...