United States
Germany
Japan
United Kingdom
China
ARMETL1 (CDNF) (NM_001029954) Human Untagged Clone
CAT＃: SC302472
CDNF (untagged)-Human cerebral dopamine neurotrophic factor (CDNF)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARMETL1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001029954 edited
AGGCGATTGAAGCTGCTGGCCCAGCATGTGGTGCGCGAGCCCAGTTGCTGTGGTGGCCTT TTGCGCCGGGCTTTTGGTCTCTCACCCGGTGCTGACGCAGGGCCAGGAGGCCGGGGGGCG GCCAGGGGCCGACTGTGAAGTATGTAAAGAATTCTTGAACCGATTCTACAAGTCACTGAT AGACAGAGGAGTTAACTTTTCGCTGGACACTATAGAGAAAGAATTGATCAGTTTTTGCTT GGACACCAAAGGAAAAGAAAACCGCCTGTGCTATTATCTAGGAGCCACAAAAGACGCAGC CACAAAGATCCTAAGTGAAGTCACTCGCCCAATGAGTGTGCATATGCCTGCAATGAAGAT TTGTGAGAAGCTGAAGAAGTTGGATAGCCAGATCTGTGAGCTGAAATATGAAAAAACACT GGACTTGGCATCAGTTGACCTGCGGAAGATGAGAGTGGCAGAGCTGAAGCAGATCCTGCA TAGCTGGGGGGAGGAGTGCAGGGCCTGTGCAGAAAAAACTGACTATGTGAATCTCATTCA AGAGCTGGCCCCCAAGTATGCAGCGACACACCCCAAAACAGAGCTCTGATCTCCAATGCC AGCACATTTGTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001029954 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001029954.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001029954.2, NP_001025125.2 |
| RefSeq Size | 1330 bp |
| RefSeq ORF | 564 bp |
| Locus ID | 441549 |
| UniProt ID | Q49AH0 |
| Gene Summary | Trophic factor for dopamine neurons. Prevents the 6-hydroxydopamine (6-OHDA)-induced degeneration of dopaminergic neurons. When administered after 6-OHDA-lesioning, restores the dopaminergic function and prevents the degeneration of dopaminergic neurons in substantia nigra (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213572 | CDNF (Myc-DDK-tagged)-Human cerebral dopamine neurotrophic factor (CDNF) |
CNY 2,400.00 |
|
| RC213572L1 | Lenti ORF clone of Human cerebral dopamine neurotrophic factor (CDNF), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC213572L2 | Lenti ORF clone of Human cerebral dopamine neurotrophic factor (CDNF), mGFP tagged |
CNY 5,890.00 |
|
| RC213572L3 | Lenti ORF clone of Human cerebral dopamine neurotrophic factor (CDNF), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213572L4 | Lenti ORF clone of Human cerebral dopamine neurotrophic factor (CDNF), mGFP tagged |
CNY 5,890.00 |
|
| RG213572 | CDNF (tGFP-tagged) - Human cerebral dopamine neurotrophic factor (CDNF) |
CNY 4,000.00 |
其它ARMETL1产品
