United States
Germany
Japan
United Kingdom
China
CUG BP1 (CELF1) (NM_001025596) Human Untagged Clone
CAT＃: SC302424
CELF1 (untagged)-Human CUGBP, Elav-like family member 1 (CELF1), transcript variant 3
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BRUNOL2; CUG-BP; CUGBP; CUGBP1; EDEN-BP; hNab50; NAB50; NAPOR |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001025596, the custom clone sequence may differ by one or more nucleotides
ATGAACGGCACCCTGGACCACCCAGACCAACCAGATCTTGATGCTATCAAGATGTTTGTGGGCCAGGTTC CAAGGACCTGGTCTGAAAAGGACTTGCGGGAACTCTTCGAACAGTATGGTGCTGTGTATGAAATCAACGT CCTAAGGGATAGGAGCCAAAACCCGCCTCAGAGCAAAGGGTGCTGTTTTGTTACATTTTACACCCGTAAA GCTGCATTAGAAGCTCAGAATGCTCTTCACAACATGAAAGTCCTCCCAGGGATGCATCACCCTATACAGA TGAAACCTGCTGACAGTGAGAAGAACAATGCAGTGGAAGACAGGAAGCTGTTTATTGGTATGATTTCCAA GAAGTGCACTGAAAATGACATCCGAGTCATGTTCTCTTCGTTTGGACAGATTGAAGAATGCCGGATATTG CGGGGACCTGATGGCCTGAGCCGAGGTTGTGCATTTGTGACTTTTACAACAAGAGCCATGGCACAGACGG CTATCAAGGCAATGCACCAAGCACAGACCATGGAGGGTTGCTCATCACCCATGGTGGTAAAATTTGCTGA TACACAGAAGGACAAAGAACAGAAGAGAATGGCCCAGCAGCTCCAGCAGCAGATGCAGCAAATCAGCGCA GCATCTGTGTGGGGAAACCTTGCTGGTCTAAATACTCTTGGACCCCAGTATTTAGCACTTTATTTGCAGC TCCTTCAGCAGACTGCCTCCTCTGGGAACCTCAACACCCTGAGCAGCCTCCACCCAATGGGAGGGTTGAA TGCAATGCAGTTACAGAATTTGGCTGCACTAGCTGCTGCAGCTAGTGCAGCTCAGAACACACCAAGTGGT ACCAATGCTCTCACTACATCCAGCAGTCCCCTCAGCGTGCTCACTAGTTCAGGGTCCTCACCTAGCTCTA GCAGCAGTAATTCTGTCAACCCCATAGCCTCACTTGGAGCCCTGCAGACATTAGCTGGAGCAACGGCTGG CCTCAATGTTGGCTCTTTGGCAGGAATGGCTGCTTTAAATGGTGGCCTGGGCAGCAGTGGCCTTTCCAAT GGCACCGGGAGCACCATGGAGGCCCTCACTCAGGCCTACTCGGGTATCCAGCAATATGCTGCTGCTGCGC TCCCCACTCTGTACAACCAGAATCTTCTGACACAGCAGAGTATTGGTGCTGCTGGAAGCCAGAAGGAAGG TCCAGAGGGAGCCAACCTGTTCATCTACCACCTGCCCCAGGAGTTTGGTGATCAGGACCTGCTGCAGATG TTTATGCCCTTTGGGAATGTCGTGTCTGCCAAGGTTTTCATAGACAAGCAGACAAACCTGAGCAAGTGTT TTGGTTTTGTAAGTTACGACAATCCTGTTTCGGCCCAAGCTGCCATCCAGTCCATGAACGGCTTTCAGAT TGGCATGAAGCGGCTTAAAGTGCAGCTCAAACGTTCGAAGAATGACAGCAAGCCCTACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001025596 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025596.1, NP_001020767.1 |
| RefSeq Size | 2024 bp |
| RefSeq ORF | 1461 bp |
| Locus ID | 10658 |
| UniProt ID | Q92879 |
| Protein Families | Druggable Genome |
| Gene Summary | Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. This gene may play a role in myotonic dystrophy type 1 (DM1) via interactions with the dystrophia myotonica-protein kinase (DMPK) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses a different splice site in its coding region compared to variant 1. The resulting isoform (3) has 4 additional internal amino acids compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222434 | CELF1 (Myc-DDK-tagged)-Human CUGBP, Elav-like family member 1 (CELF1), transcript variant 3 |
CNY 5,488.00 |
|
| RC222434L3 | Lenti ORF clone of Human CUGBP, Elav-like family member 1 (CELF1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222434L4 | Lenti ORF clone of Human CUGBP, Elav-like family member 1 (CELF1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG222434 | CELF1 (tGFP-tagged) - Human CUGBP, Elav-like family member 1 (CELF1), transcript variant 3 |
CNY 4,370.00 |
其它CUG BP1产品
