DUT (NM_001025249) Human Untagged Clone

CAT#: SC302383

DUT (untagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 3



  "NM_001025249" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DUT Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dUTPase
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302383 representing NM_001025249.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCTCCGCTTTGCCCGGCTCTCCGAGCACGCCACGGCCCCCACCCGGGGCTCCGCGCGCGCCGCG
GGCTACGACCTGTACAGTGCCTATGATTACACAATACCACCTATGGAGAAAGCTGTTGTGAAAACGGAC
ATTCAGATAGCGCTCCCTTCTGGGTGTTATGGAAGAGTGGCTCCACGGTCAGGCTTGGCTGCAAAACAC
TTTATTGATGTAGGAGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGTTGTACTGTTTAAT
TTTGGCAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTCATTTGCGAACGGATTTTT
TATCCAGAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAAAGGGGTTCAGGAGGTTTTGGTTCCACT
GGAAAGAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001025249
Insert Size 426 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025249.1
RefSeq Size 1830 bp
RefSeq ORF 426 bp
Locus ID 1854
UniProt ID P33316
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pyrimidine metabolism
MW 15.4 kDa
Gene Summary This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream start codon, compared to variant 1. It encodes isoform 3, which has a shorter N-terminus that lacks the mitochondrial targeting sequence, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...