United States
Germany
Japan
United Kingdom
China
Myelin Basic Protein (MBP) (NM_001025090) Human Untagged Clone
CAT＃: SC302343
MBP (untagged)-Human myelin basic protein (MBP), transcript variant 3
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001025090 edited
ATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGT ACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGAC TCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGAC TCACACCACCCGGCAAGAACTGCTCACTACGGCTCCCTGCCCCAGAAGTCACACGGCCGG ACCCAAGATGAAAACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCA CCCCCGTCGCAGGGAAAGGGGAGAGGACTGTCCCTGAGCAGATTTAGCTGGGGGGCCGAA GGCCAGAGACCAGGATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAG GGATTCAAGGGAGTCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGA GATAGTCGCTCTGGATCACCCATGGCTAGACGCTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001025090 |
| Insert Size | 2300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001025090.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025090.1, NP_001020261.1 |
| RefSeq Size | 2222 bp |
| RefSeq ORF | 516 bp |
| Locus ID | 4155 |
| UniProt ID | P02686 |
| Gene Summary | The protein encoded by the classic MBP gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, MBP-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long MBP gene (otherwise called "Golli-MBP") that contains 3 additional exons located upstream of the classic MBP exons. Alternative splicing from the Golli and the MBP transcription start sites gives rise to 2 sets of MBP-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-MBP, spliced in-frame to 1 or more MBP exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to MBP aa sequence. The second family of transcripts contain only MBP exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the MBP transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks exon 2 compared to transcript variant 1 and encodes one of the classic MBP isoforms (3) that is missing a 26 aa segment compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200710 | MBP (Myc-DDK-tagged)-Human myelin basic protein (MBP), transcript variant 3 |
CNY 2,400.00 |
|
| RC200710L3 | Lenti ORF clone of Human myelin basic protein (MBP), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC200710L4 | Lenti ORF clone of Human myelin basic protein (MBP), transcript variant 3, mGFP tagged |
CNY 4,800.00 |
|
| RG200710 | MBP (tGFP-tagged) - Human myelin basic protein (MBP), transcript variant 3 |
CNY 4,000.00 |
其它Myelin Basic Protein产品
