United States
Germany
Japan
United Kingdom
China
ARPP21 (NM_001025069) Human Untagged Clone
CAT＃: SC302332
ARPP21 (untagged)-Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARPP-21; R3HDM3; RCS; TARPP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302332 representing NM_001025069.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGAGCAAGGAGACCTGAATCAGGCAATAGCAGAGGAAGGAGGGACTGAGCAGGAGACGGCCACT CCAGAGAACGGCATTGTTAAATCAGAAAGTCTGGATGAAGAGGAGAAACTGGAACTGCAGAGGCGGCTG GAGGCTCAGAATCAAGAAAGAAGAAAATCCAAGTCAGGAGCAGGAAAAGGTAAACTGACTCGCAGCCTT GCTGTCTGTGAGGAATCTTCTGCCAGACCAGGAGGTGAAAGTCTTCAGGATCAGACTCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001025069 |
| Insert Size | 270 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025069.1 |
| RefSeq Size | 2418 bp |
| RefSeq ORF | 270 bp |
| Locus ID | 10777 |
| UniProt ID | Q9UBL0 |
| MW | 9.7 kDa |
| Gene Summary | This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (4) uses two alternate 5' exons and an alternate 3' exon compared to variant 1. The resulting isoform (2) has a distinct and much shorter C-terminus compared to isoform 1. Variants 2, 3, 4, 5 and 7 all encode the same isoform (2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224485 | ARPP21 (Myc-DDK-tagged)-Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 4 |
CNY 1,200.00 |
|
| RC224485L3 | Lenti ORF clone of Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224485L4 | Lenti ORF clone of Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
| RG224485 | ARPP21 (tGFP-tagged) - Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 4 |
CNY 4,370.00 |
