ARPC4 (NM_001024960) Human Untagged Clone
CAT#: SC302330
ARPC4 (untagged)-Human actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARC20; P20-ARC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001024960, the custom clone sequence may differ by one or more nucleotides
ATGCGCTTCATGATGATGCGAGCAGAGAACTTCTTTATCCTTCGAAGGAAGCCTGTGGAG GGGTATGATATCAGCTTTCTGATCACCAACTTCCACACAGAGCAGATGTACAAACACAAG TTGGTGGACTTTGTGATCCACTTCATGGAGGAGATTGACAAGGAGATCAGTGAGATGAAG CTGTCAGTCAATGCCCGTGCCCGCATTGTGGCTGAAGAGTTCCTTAAGAATTTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001024960 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001024960.1, NP_001020131.1 |
RefSeq Size | 1412 bp |
RefSeq ORF | 237 bp |
Locus ID | 10093 |
UniProt ID | P59998 |
Protein Pathways | Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton |
Gene Summary | This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit, which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family, member 3 (TTLL3), which results in the production of a fusion protein. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode isoform b. CCDS Note: This CCDS represents a variant of the ARPC4 locus, and is supported by EST data, including BI768875.1, BQ688329.1, BU161393.1 and BG938423.1. A variant encoding a longer protein is represented by CCDS43047.1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218070 | ARPC4 (Myc-DDK-tagged)-Human actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4), transcript variant 3 |
CNY 3,990.00 |
|
RC218070L3 | Lenti-ORF clone of ARPC4 (Myc-DDK-tagged)-Human actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4), transcript variant 3 |
CNY 5,890.00 |
|
RC218070L4 | Lenti-ORF clone of ARPC4 (mGFP-tagged)-Human actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4), transcript variant 3 |
CNY 5,890.00 |
|
RG218070 | ARPC4 (tGFP-tagged) - Human actin related protein 2/3 complex, subunit 4, 20kDa (ARPC4), transcript variant 3 |
CNY 4,370.00 |