TM2D2 (NM_001024380) Human Untagged Clone

CAT#: SC302243

TM2D2 (untagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 3



  "NM_001024380" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TM2D2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BLP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302243 representing NM_001024380.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGAAATGTCTTTTGCCCGTTTTGATTACGTGCATGCAAACAGCGATTTGCAAAGACCGTATGATG
ATGATCATGATCTTACTGGTGAATTACAGACCTGATGAATTTATAGAATGTGAAGACCCAGTGGATCAT
GTTGGAAATGCAACTGCATCCCAGGAACTTGGTTATGGTTGTCTCAAGTTCGGCGGTCAGGCCTACAGC
GACGTGGAACACACTTCAGTCCAGTGCCATGCCTTAGATGGAATTGAGTGTGCCAGTCCTAGGACCTTT
CTACGAGAAAATAAACCTTGTATAAAGTATACCGGACACTACTTCATAACCACTTTACTCTACTCCTTC
TTCCTGGGATGTTTTGGTGTGGATCGATTCTGTTTGGGACACACTGGCACTGCAGTAGGGAAGCTGTTG
ACGCTTGGAGGACTTGGGATTTGGTGGTTTGTTGACCTTATTTTGCTAATTACTGGAGGGCTGATGCCA
AGTGATGGCAGCAACTGGTGCACTGTTTACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001024380
Insert Size 516 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024380.1
RefSeq Size 3435 bp
RefSeq ORF 516 bp
Locus ID 83877
UniProt ID Q9BX73
Protein Families Druggable Genome, Transmembrane
MW 19 kDa
Gene Summary The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. This gene has multiple alternatively spliced transcript variants which encode two different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...