United States
Germany
Japan
United Kingdom
China
ARF1 (NM_001024228) Human Untagged Clone
CAT＃: SC302241
ARF1 (untagged)-Human ADP-ribosylation factor 1 (ARF1), transcript variant 2
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PVNH8 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302241 representing NM_001024228.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGAACATCTTCGCCAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATCCTCATGGTG GGCCTGGATGCTGCAGGGAAGACCACGATCCTCTACAAGCTTAAGCTGGGTGAGATCGTGACCACCATT CCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGACGTGGGT GGCCAGGACAAGATCCGGCCCCTGTGGCGCCACTACTTCCAGAACACACAAGGCCTGATCTTCGTGGTG GACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAG CTCCGGGATGCTGTCCTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAG ATCACAGACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCCACC AGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001024228 |
| Insert Size | 546 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001024228.1 |
| RefSeq Size | 1998 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 375 |
| UniProt ID | P84077 |
| Protein Pathways | Vibrio cholerae infection |
| MW | 20.7 kDa |
| Gene Summary | ADP-ribosylation factor 1 (ARF1) is a member of the human ARF gene family. The family members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking as activators of phospholipase D. The gene products, including 6 ARF proteins and 11 ARF-like proteins, constitute a family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2 and ARF3), class II (ARF4 and ARF5) and class III (ARF6), and members of each class share a common gene organization. The ARF1 protein is localized to the Golgi apparatus and has a central role in intra-Golgi transport. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks a segment in the 5' UTR, as compared to variant 1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The brefeldin A-inhibited guanine nucleotide-exchange protein, BIG2, regulates the constitutive release of TNFR1 exosome-like vesicles
,Aminul Islam, Xiaoyan Shen, Toyoko Hiroi, Joel Moss, Martha Vaughan, and Stewart J Levine,
J Biol Chem. 2007 Mar 30;282(13):9591-9.
[ARF1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212099 | ARF1 (Myc-DDK-tagged)-Human ADP-ribosylation factor 1 (ARF1), transcript variant 2 |
CNY 2,400.00 |
|
| RC212099L3 | Lenti ORF clone of Human ADP-ribosylation factor 1 (ARF1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212099L4 | Lenti ORF clone of Human ADP-ribosylation factor 1 (ARF1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212099 | ARF1 (tGFP-tagged) - Human ADP-ribosylation factor 1 (ARF1), transcript variant 2 |
CNY 4,370.00 |
