FBLIM1 (NM_001024216) Human Untagged Clone

CAT#: SC302237

FBLIM1 (untagged)-Human filamin binding LIM protein 1 (FBLIM1), transcript variant 3



  "NM_001024216" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
FBLIM1 mouse monoclonal antibody, clone OTI3G1 (formerly 3G1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAL; FBLP-1; FBLP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302237 representing NM_001024216.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTCAAAGCCTGAGAAGAGGGTGGCATCGTCTGTCTTTATCACCCTGGCACCCCCGCGCCGCGAT
GTGGCCGTGGCGGAGGAAGTGAGGCAGGCAGTTTGTGAGGCCCGGCGTGGCCGCCCCTGGGAGGCTCCT
GCCCCCATGAAGACACCCGAGGCTGGCTTGGCGGGGAGGCCCAGCCCCTGGACAACCCCTGGCAGAGCT
GCAGCCACAGTGCCGGCTGCACCTATGCAGCTCTTCAATGGAGACATCTGTGCCTTCTGCCACAAGACC
GTGTCCCCCCGAGAGCTGGCTGTGGAGGCCATGAAGAGGCAGTACCATGCCCAGTGCTTCACGTGCCGC
ACCTGCCGCCGCCAGCTGGCTGGGCAGAGCTTCTACCAGAAGGATGGGCGACCCCTCTGCGAACCCTGC
TACCAGGACACACTGGAGAGGTGCGGCAAGTGTGGCGAGGTGGTCCGGGACCACATCATCAGGGCCCTG
GGCCAGGCCTTCCACCCCTCCTGCTTCACGTGTGTGACCTGCGCCCGGTGCATTGGGGATGAGAGCTTT
GCCCTGGGCAGCCAGAACGAGGTGTACTGCCTGGACGACTTCTACAGGAAATTCGCCCCCGTCTGCAGC
ATCTGTGAAAATCCCATCATCCCTCGGGATGGGAAAGATGCCTTCAAAATCGAATGCATGGGAAGAAAC
TTCCATGAAAATTGCTACAGGTGTGAGGACTGCAGGATCCTCCTGTCTGTCGAGCCCACGGACCAAGGC
TGCTACCCCCTGAACAACCATCTCTTCTGCAAGCCATGCCATGTGAAGCGGAGTGCTGCGGGGTGCTGC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001024216
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024216.1
RefSeq Size 2793 bp
RefSeq ORF 831 bp
Locus ID 54751
UniProt ID Q8WUP2
MW 30.8 kDa
Gene Summary This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks multiple alternate in-frame exons, compared to variant 1, resulting in a shorter protein (isoform c), compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...