PAEP (NM_001018049) Human Untagged Clone

CAT#: SC302139

PAEP (untagged)-Human progestagen-associated endometrial protein (PAEP), transcript variant 1



  "NM_001018049" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PAEP Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GD; GdA; GdF; GdS; PAEG; PEP; PP14; ZIF-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001018049 edited
ATGCTGTGCCTCCTGCTCACCCTGGGCGTGGCCCTGGTCTGTGGTGTCCCGGCCATGGAC
ATCCCCCAGACCAAGCAGGACCTGGAGCTCCCAAAGTTGGCAGGGACCTGGCACTCCATG
GCCATGGCGACCAACAACATCTCCCTCATGGCGACACTGAAGGCCCCTCTGAGGGTCCAC
ATCACCTCACTGTTGCCCACCCCCGAGGACAACCTGGAGATCGTTCTGCACAGATGGGAG
AACAACAGCTGTGTTGAGAAGAAGGTCCTTGGAGAGAAGACTGAGAATCCAAAGAAGTTC
AAGATCAACTATACGGTGGCGAACGAGGCCACGCTGCTCGATACTGACTACGACAATTTC
CTGTTTCTCTGCCTACAGGACACCACCACCCCCATCCAGAGCATGATGTGCCAGTACCTG
GCCAGAGTCCTGGTGGAGGACGATGAGATCATGCAGGGATTCATCAGGGCTTTCAGGCCC
CTGCCCAGGCACCTATGGTACTTGCTGGACTTGAAACAGATGGAAGAGCCGTGCCGTTTC
TAGGTGAGCTCCTGCCTGGTCCTGCCTCCTGGCTCACCTCCGCCTCCAGGAAGACCAGAC
TCCCACCCTTCCACACCTCCAGAGCAGTGGGACTTCCTCCTGCCCTTT
Restriction Sites Please inquire     
ACCN NM_001018049
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001018049.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001018049.1, NP_001018059.1
RefSeq Size 857 bp
RefSeq ORF 543 bp
Locus ID 5047
UniProt ID P09466
Protein Families Druggable Genome
Gene Summary This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...