United States
Germany
Japan
United Kingdom
China
CD64 (FCGR1B) (NM_001017986) Human Untagged Clone
CAT＃: SC302106
FCGR1B (untagged)-Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD64b; FCG1; FcgammaRIa; FCGR1; FCGR1A; FcRI; IGFR1; IGFRB |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001017986 edited
GAATTCGGCACGAGGCCAGCTTGGAGACAACATGTGGTTCTTGACAACTCTGCTCCTTTG GGTTCCAGTTGATGGGCAAGTGGACACCACAAAGGCAGTGATCACTTTGCAGCCTCCATG GGTCAGCGTGTTCCAAGAGGAAACCGTAACCTTGCACTGTGAGGTGCTCCATCTGCCTGG GAGCAGCTCTACACAGTGGTTTCTCAATGGCACAGCCACTCAGACCTCGACCCCCAGCTA CAGAATCACCTCTGCCAGTGTCAATGACAGTGGTGAATACAGGTGCCAGAGAGGTCTCTC AGGGCGAAGTGACCCCATACAGCTGGAAATCCACAGAGGCTGGCTACTACTGCAGGTCTC CAGCAGAGTCTTCACGGAAGGAGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATAA GCTGGTGTACAATGTGCTTTACTATCGAAATGGCAAAGCCTTTAAGTTTTTCCACTGGAA TTCTAACCTCACCATTCTGAAAACCAACATAAGTCACAATGGCACCTACCATTGCTCAGG CATGGGAAAGCATCGCTACACATCAGCAGGAATATCACAATACACTGTGAAAGGCCTCCA GTTACCAACTCCTGTCTGGTTTCATGTCCTTTTCTATCTGGCAGTGGGAATAATGTTTTT AGTGAACACTGTTCTCTGGGTGACAATACGTAAAGAACTGAAAAGAAAGAAAAAGTGGAA TTTAGAAATCTCTTTGGATTCTGGTCATGAGAAGAAGGTAATTTCCAGCCTTCAAGAAGA CAGACATTTAGAAGAAGAGCTGAAATGTCAGGAACAAAAAGAAGAACAGCTGCAGGAAGG GGTGCACCGGAAGGAGCCCCAGGGGGCCACGTAGCAGCGGCTCAGTGGGTGGCCATCGAT CTGGACCGTCCCCTGCCCACTTGCTCCCCGTGAGCACTGCGTACAAACATCCAAAAGTTC AACAACACCAGAACTGTGTGTCTCATGGTATATAACTCTTAAAGCAAATAAATGAACTGA CTTC |
| Restriction Sites | Please inquire |
| ACCN | NM_001017986 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found two SNPs within the protein associated with this reference, NM_001017986.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001017986.1, NP_001017986.1 |
| RefSeq Size | 846 bp |
| RefSeq ORF | 843 bp |
| Locus ID | 2210 |
| UniProt ID | Q92637 |
| Protein Families | Transmembrane |
| Gene Summary | Three distinct, but closely related classes of receptors that bind the Fc portion of IgG have been identified (Fcgamma RI, II and III). The FcgammaRI family consists of three closely related genes termed A, B, and C. This gene likely encodes a non-functional protein that is not detectable at the cell surface and binds ligand with low affinity. [provided by RefSeq, Nov 2019] Transcript Variant: This variant (1, also known as B1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224447 | FCGR1B (Myc-DDK-tagged)-Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 1 |
CNY 2,400.00 |
|
| RC224447L3 | Lenti ORF clone of Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224447L4 | Lenti ORF clone of Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG224447 | FCGR1B (tGFP-tagged) - Human Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 1 |
CNY 4,370.00 |
