United States
Germany
Japan
United Kingdom
China
COP (CARD16) (NM_001017534) Human Untagged Clone
CAT＃: SC302066
CARD16 (untagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 1
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | COP; COP1; PSEUDO-ICE |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001017534 edited
ATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCATTCCATGGGTGAAGGT ACAATAAATGGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACCAGGAAGAGATG GAGAAAGTAAAACGTGAAAATGCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCC GTTATTCCGAAAGGGGCACAGGCATGCCAAATTTGCATCACATACATTTGTGAAGAAGAC AGTTACCTGGCAGAGACGCTGGGACTCTCAGCAGCTCTTCAGGCAGTGCAGGACAACCCA GCTATGCCCACATGCTCAAGCCCAGAAGGCAGAATCAAGCTTTGCTTTCTAGAAGACGCT CAAAGGATATGGAAACAAAAGTTGCAGAGGTGCCATGTTCAGAATACAATAATAAAGTGG AGTGAAAGATATACTTCAGGCAGTTTTGAAATGCAGTGGCTTTTTCTTAGAACCAATTTT ATTGAGCGGTTCTGGAGGAACATACTTCTGCTCCCCTTGCATAAAGGATCTCTATATCCT AGAATCCCAGGTTTAGGTAAAGAGTTGCAAACTGGAACTCATAAATTATCATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001017534 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001017534.1, NP_001017534.1 |
| RefSeq Size | 695 bp |
| RefSeq ORF | 594 bp |
| Locus ID | 114769 |
| UniProt ID | Q5EG05 |
| Gene Summary | Caspase inhibitor. Acts as a regulator of procaspase-1/CASP1 activation implicated in the regulation of the proteolytic maturation of pro-interleukin-1 beta (IL1B) and its release during inflammation. Inhibits the release of IL1B in response to LPS in monocytes. Also induces NF-kappa-B activation during the pro-inflammatory cytokine response. Also able to inhibit CASP1-mediated neuronal cell death, TNF-alpha, hypoxia-, UV-, and staurosporine-mediated cell death but not ER stress-mediated cell death. Acts by preventing activation of caspases CASP1 and CASP4, possibly by preventing the interaction between CASP1 and RIPK2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217985 | CARD16 (Myc-DDK-tagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 1 |
CNY 3,600.00 |
|
| RC217985L3 | Lenti ORF clone of Human caspase recruitment domain family, member 16 (CARD16), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217985L4 | Lenti ORF clone of Human caspase recruitment domain family, member 16 (CARD16), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG217985 | CARD16 (tGFP-tagged) - Human caspase recruitment domain family, member 16 (CARD16), transcript variant 1 |
CNY 5,200.00 |
