UFSP1 (NM_001015072) Human Untagged Clone

CAT#: SC301999

UFSP1 (untagged)-Human UFM1-specific peptidase 1 (non-functional) (UFSP1)



  "NM_001015072" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-UFSP1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UFSP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301999 representing NM_001015072.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGACAAGCCCCCCGGCTTCCGGGGCTCCCGGGACTGGATCGGCTGCGTGGAGGCCAGCCTCTGC
CTCGCTCACTTCGGAGGGCCCCAGGGACGCCTCTGCCACGTACCCCGGGGAGTGGGGCTGCACGGGGAG
CTGGAGAGGCTTTACTCGCACTTCGCAGGGGGTGGGGGCCCAGTCATGGTTGGGGGGGACGCAGATGCC
AGGTCCAAGGCCTTGCTGGGAGTCTGCGTAGGGTCAGGCACGGAAGCCTATGTCCTGGTATTGGACCCT
CACTACTGGGGCACTCCAAAAAGCCCCAGTGAACTACAGGCTGCTGGGTGGGTGGGCTGGCAAGAGGTG
AGTGCAGCCTTTGACCCCAACTCCTTCTACAACCTGTGCTTGACCAGCCTTAGCTCCCAACAGCAGCAG
CGCACCTTGGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001015072
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015072.3
RefSeq Size 1016 bp
RefSeq ORF 429 bp
Locus ID 402682
UniProt ID Q6NVU6
MW 15.1 kDa
Gene Summary This gene encodes a protein that is similar to other Ufm1-specific proteases. Studies in mouse determined that Ufsp1 releases Ufm1 (ubiquitin-fold modifier 1) from its bound conjugated complexes which also makes it into an active form. Because the human UFSP1 protein is shorter on the N-terminus and lacks a conserved Cys active site, it is predicted to be non-functional.[provided by RefSeq, Nov 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...