SLX1 (SLX1A) (NM_001015000) Human Untagged Clone
CAT#: SC301982
SLX1A (untagged)-Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GIYD1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301982 representing NM_001015000.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTCCCGCGGGGGTCGCGGCGAGGCCAGGGCGCTTTTTCGGCGTCTACCTGCTCTACTGCCTGAAC CCCCGGTACCGGGGCCGCGTCTACGTGGGGTTCACTGTCAACACTGCTCGTCGGGTCCAGCAGCACAAT GGGGGCCGCAAAAAAGGCGGGGCCTGGCGGACCAGCGGGCGAGGGCCCTGGGAGATGGTGCTCGTCGTG CACGGCTTCCCGTCCTCCGTGGCCGCCCTTCGGGATGAAGAGGGGCCCTTGTGTTGCCCCCACCCTGGC TGCCTGCTAAGGGCCCATGTGATCTGCCTGGCAGAGGAGTTTCTTCAGGAAGAACCAGGGCAGCTTCTG CCCCTAGAGGGCCAATGCCCTTGCTGTGAGAAGTCACTGCTTTGGGGAGACCTGATCTGGCTGTGCCAG ATGGACACTGAGAAAGAAGTAGAAGACTCAGAATTAGAAGAGGCACACTGGACAGACCTGCTGGAGACC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001015000 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001015000.2 |
RefSeq Size | 828 bp |
RefSeq ORF | 486 bp |
Locus ID | 548593 |
UniProt ID | Q9BQ83 |
MW | 18 kDa |
Gene Summary | This gene encodes a protein that is an important regulator of genome stability. The protein represents the catalytic subunit of the SLX1-SLX4 structure-specific endonuclease, which can resolve DNA secondary structures that are formed during repair and recombination processes. Two identical copies of this gene are located on the p arm of chromosome 16 due to a segmental duplication; this record represents the more centromeric copy. Alternative splicing results in multiple transcript variants. Read-through transcription also occurs between this gene and the downstream SULT1A3 (sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3) gene. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220520 | SLX1A (Myc-DDK-tagged)-Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2 |
CNY 1,200.00 |
|
RC220520L1 | Lenti ORF clone of Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC220520L2 | Lenti ORF clone of Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC220520L3 | Lenti ORF clone of Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220520L4 | Lenti ORF clone of Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG220520 | SLX1A (tGFP-tagged) - Human SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) (SLX1A), transcript variant 2 |
CNY 4,370.00 |