FBXO44 (NM_001014765) Human Untagged Clone
CAT#: SC301952
FBXO44 (untagged)-Human F-box protein 44 (FBXO44), transcript variant 4
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FBG3; FBX6A; FBX30; Fbx44; Fbxo6a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301952 representing NM_001014765.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGTGGGGAACATCAACGAGCTGCCCGAGAACATCCTGCTGGAGCTGTTCACGCACGTGCCCGCC CGCCAGCTGCTGCTGAACTGCCGCCTGGTCTGCAGCCTCTGGCGGGACCTCATCGACCTCGTGACCCTC TGGAAACGCAAGTGCCTGCGAGAGGGCTTCATCACTGAGGACTGGGACCAGCCCGTGGCCGACTGGAAG ATCTTCTACTTCTTACGGAGCCTGCACAGGAACCTCCTGCACAACCCGTGCGCTGAAGAGGGGTTCGAG TTCTGGAGCCTGGATGTGAATGGAGGCGATGAGTGGAAGGTGGAGGATCTCTCTCGAGACCAGAGGAAG GAATTCCCCAATGACCAGGTCAAGAAATACTTCGTTACTTCATATTACACCTGCCTCAAGTCCCAGGTG GTGGACCTCAAGGCCGAAGGGTATTGGGAGGAGCTGATGGATACCACACGGCCGGACATCGAGGTCAAG GACTGGTTCGCAGCCAGGCCAGATTGCGGGTCCAAGTACCAGCTGTGCGTTCAGCTCCTGTCGTCCGCG CACGCGCCTCTGGGGACCTTCCAGCCAGACCCGGCGACCATCCAGCAGAAGAGCGATGCCAAGTGGAGG GAGGTCTCCCACACATTCTCCAACTACCCGCCCGGCGTCCGCTACATCTGGTTTCAGCACGGCGGCGTG GACACTCATTACTGGGCCGGCTGGTACGGCCCGAGGGTCACCAACAGCAGCATCACCATCGGGCCCCCG CTGCCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001014765 |
Insert Size | 768 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001014765.1 |
RefSeq Size | 3320 bp |
RefSeq ORF | 768 bp |
Locus ID | 93611 |
UniProt ID | Q9H4M3 |
Protein Families | Druggable Genome |
MW | 29.7 kDa |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Several alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Feb 2015] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 4, and 6 all encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212532 | FBXO44 (Myc-DDK-tagged)-Human F-box protein 44 (FBXO44), transcript variant 4 |
CNY 2,400.00 |
|
RC212532L1 | Lenti ORF clone of Human F-box protein 44 (FBXO44), transcript variant 4, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC212532L2 | Lenti ORF clone of Human F-box protein 44 (FBXO44), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RC212532L3 | Lenti ORF clone of Human F-box protein 44 (FBXO44), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212532L4 | Lenti ORF clone of Human F-box protein 44 (FBXO44), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG212532 | FBXO44 (tGFP-tagged) - Human F-box protein 44 (FBXO44), transcript variant 4 |
CNY 4,000.00 |