United States
Germany
Japan
United Kingdom
China
Kallikrein 6 (KLK6) (NM_001012965) Human Untagged Clone
CAT＃: SC301735
KLK6 (untagged)-Human kallikrein-related peptidase 6 (KLK6), transcript variant C
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Bssp; hK6; Klk7; PRSS9; PRSS18; SP59 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301735 representing NM_001012965.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGTTGCGCCTGGCACGCCCAGCCAAACTCTCTGAACTCATCCAGCCCCTTCCCCTGGAGAGGGAC TGCTCAGCCAACACCACCAGCTGCCACATCCTGGGCTGGGGCAAGACAGCAGATGGTGATTTCCCTGAC ACCATCCAGTGTGCATACATCCACCTGGTGTCCCGTGAGGAGTGTGAGCATGCCTACCCTGGCCAGATC ACCCAGAACATGTTGTGTGCTGGGGATGAGAAGTACGGGAAGGATTCCTGCCAGGGTGATTCTGGGGGT CCGCTGGTATGTGGAGACCACCTCCGAGGCCTTGTGTCATGGGGTAACATCCCCTGTGGATCAAAGGAG AAGCCAGGAGTCTACACCAACGTCTGCAGATACACGAACTGGATCCAAAAAACCATTCAGGCCAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001012965 |
| Insert Size | 414 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001012965.2 |
| RefSeq Size | 1676 bp |
| RefSeq ORF | 414 bp |
| Locus ID | 5653 |
| UniProt ID | Q92876 |
| Protein Families | Druggable Genome, Protease, Secreted Protein |
| MW | 15.1 kDa |
| Gene Summary | This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (C, also known as 2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream translation start site compared to variant A. The resulting isoform (B) has a shorter N-terminus compared to isoform A. Variants C-E encode the same isoform (B). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221436 | KLK6 (Myc-DDK-tagged)-Human kallikrein-related peptidase 6 (KLK6), transcript variant C |
CNY 2,400.00 |
|
| RC221436L1 | Lenti ORF clone of Human kallikrein-related peptidase 6 (KLK6), transcript variant C, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC221436L2 | Lenti ORF clone of Human kallikrein-related peptidase 6 (KLK6), transcript variant C, mGFP tagged |
CNY 5,890.00 |
|
| RC221436L3 | Lenti ORF clone of Human kallikrein-related peptidase 6 (KLK6), transcript variant C, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC221436L4 | Lenti ORF clone of Human kallikrein-related peptidase 6 (KLK6), transcript variant C, mGFP tagged |
CNY 5,890.00 |
|
| RG221436 | KLK6 (tGFP-tagged) - Human kallikrein-related peptidase 6 (KLK6), transcript variant C |
CNY 4,370.00 |
其它Kallikrein 6产品
