United States
Germany
Japan
United Kingdom
China
IL32 (NM_001012718) Human Untagged Clone
CAT＃: SC301707
IL32 (untagged)-Human interleukin 32 (IL32), transcript variant 8
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301707 representing NM_001012718.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGCACCAGGCCATAGAA AGATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGACAGGTGATGTCGAGCCTGGCAGAGCTG GAGGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCTTATTATGAGGAGCAGCACCCAGAGCTC ACTCCTCTACTTGAAAAAGAAAGAGATGGATTACGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTT GAGGATCCCGCAACCGAGGAGCCTGGGGAGAGCTTTTGTGACAAGGTCATGAGATGGTTCCAGGCCATG CTGCAGCGGCTGCAGACCTGGTGGCACGGGGTTCTGGCCTGGGTGAAGGAGAAGGTGGTGGCCCTGGTC CATGCAGTGCAGGCCCTCTGGAAACAGTTCCAGAGTTTCTGCTGCTCTCTGTCAGAGCTCTTCATGTCC TCTTTCCAGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACACCCCAGAAGTGCTCTGAACCC CAATCCTCAAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001012718 |
| Insert Size | 567 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001012718.1 |
| RefSeq Size | 1093 bp |
| RefSeq ORF | 567 bp |
| Locus ID | 9235 |
| UniProt ID | P24001 |
| Protein Families | Secreted Protein |
| MW | 21.7 kDa |
| Gene Summary | This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8) contains an alternate in-frame splice site in the 5' UTR compared to variant 1. Variants 1 and 8 encode the same protein, isoform B, also referred to as IL-32beta. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217258 | IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 8 |
CNY 2,400.00 |
|
| RC217258L1 | Lenti ORF clone of Human interleukin 32 (IL32), transcript variant 8, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC217258L2 | Lenti ORF clone of Human interleukin 32 (IL32), transcript variant 8, mGFP tagged |
CNY 5,890.00 |
|
| RC217258L3 | Lenti ORF clone of Human interleukin 32 (IL32), transcript variant 8, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217258L4 | Lenti ORF clone of Human interleukin 32 (IL32), transcript variant 8, mGFP tagged |
CNY 5,890.00 |
|
| RG217258 | IL32 (tGFP-tagged) - Human interleukin 32 (IL32), transcript variant 8 |
CNY 4,370.00 |
