ASB11 (NM_001012428) Human Untagged Clone

CAT#: SC301659

ASB11 (untagged)-Human ankyrin repeat and SOCS box containing 11 (ASB11), transcript variant 2



  "NM_001012428" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ASB11 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301659 representing NM_001012428.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTCAATTAACTGGGGAAAATGAGAAGAATTGTGAAGTTTCAGAACGTATCAGAAGGTCCGGACCA
TGGAAAGAGATTTCTTTTGGGGATTATATTTGTCACACATTTCAGGGAGATTGCTGGGCTGATCGATCC
CCACTTCATGAAGCTGCAGCTCAGGGGCGCTTACTGGCCCTTAAAACTTTAATTGCACAAGGTGTCAAT
GTGAACCTTGTGACAATTAACCGGGTGTCTTCTCTCCACGAGGCATGCCTTGGAGGTCACGTGGCCTGT
GCCAAAGCCTTATTGGAAAATGGTGCACACGTCAATGGAGTGACAGTTCACGGAGCCACACCCCTCTTC
AATGCTTGCTGCAGCGGCAGTGCTGCATGTGTCAATGTGCTGCTGGAGTTCGGAGCCAAGGCCCAGTTG
GAGGTGCACCTGGCCTCGCCCATCCATGAGGCAGTGAAGAGAGGTCACAGAGAGTGCATGGAGATCCTG
CTGGCAAATAATGTTAACATTGACCATGAGGTGCCTCAGCTCGGAACTCCCCTATATGTGGCCTGCACC
TACCAGAGGGTAGACTGTGTGAAGAAACTTCTAGAATTAGGAGCCAGTGTCGACCATGGCCAGTGGCTG
GACACCCCACTCCATGCTGCAGCGAGGCAGTCCAATGTGGAGGTCATCCACCTGCTAACCGACTATGGA
GCTAACCTGAAGCGTAGAAATGCTCAGGGCAAAAGTGCGCTTGATCTGGCGGCTCCAAAAAGCAGCGTG
GAGCAGGCACTCTTGCTCCGTGAAGGCCCACCTGCTCTTTCCCAGCTCTGCCGCCTGTGTGTCCGGAAG
TGTCTCGGTCGAGCATGTCATCAAGCCATCCACAAGCTACATCTGCCAGAGCCACTCGAACGATTCCTC
CTATACCAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001012428
Insert Size 909 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001012428.2
RefSeq Size 2790 bp
RefSeq ORF 909 bp
Locus ID 140456
UniProt ID Q8WXH4
Protein Families Druggable Genome, Transmembrane
MW 33 kDa
Gene Summary The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...