LECT1 (CNMD) (NM_001011705) Human Untagged Clone
CAT#: SC301600
LECT1 (untagged)-Human leukocyte cell derived chemotaxin 1 (LECT1), transcript variant 2
CNY 3,656.00
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRICD3; CHM-I; CHM1; LECT1; MYETS1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301600 representing NM_001011705.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAGAGAACTCCGACAAAGTTCCCATTGCCCTGGTGGGACCTGATGACGTGGAATTCTGCAGCCCC CCGGCGTACGCTACGCTGACGGTGAAGCCCTCCAGCCCCGCGCGGCTGCTCAAGGTGGGAGCCGTGGTC CTCATTTCGGGAGCTGTGCTGCTGCTCTTTGGGGCCATCGGGGCCTTCTACTTCTGGAAGGGGAGCGAC AGTCACATTTACAATGTCCATTACACCATGAGTATCAATGGGAAATTACAAGATGGGTCAATGGAAATA GACGCTGGGAACAACTTGGAGACCTTTAAAATGGGAAGTGGAGCTGAAGAAGCAATTGCAGTTAATGAT TTCCAGAATGGCATCACAGGAATTCGTTTTGCTGGAGGAGAGAAGTGCTACATTAAAGCGCAAGTGAAG GCTCGTATTCCTGAGGTGGGCGCCGTGACCAAACAGAGCATCTCCTCCAAACTGGAAGGCAAGATCATG CCAGTCAAATATGAAGAAAATTCTCTTATCTGGGTGGCTGTAGATCAGCCTGTGAAGGACAACAGCTTC TTGAGTTCTAAGGTGTTAGAACTCTGCGGTGACCTTCCTATTTTCTGGCTTAAACCAACCTATCCAAAA GAAATCCAGAGGGAAAGAAGAGAAGTGGTAAGAAAAATTGTTCCAACTACCACAAAAAGACCACACAGT GGACCACGGAGCAACCCAGGCGCTGGAAGACTGAATAATGAAACCAGACCCAGTGTTCAAGAGGACTCA CAAGCCTTCAATCCTGATAATCCTTATCATCAGGAAGGGGAAAGCATGACATTCGACCCTAGACTGGAT CACGAAGGAATCTGTTGTATAGAATGTAGGCGGAGCTACACCCACTGCCAGAAGATCTGTGAACCCCTG GGGGGCTATTACCCATGGCCTTATAATTATCAAGGCTGCCGTTCGGCCTGCAGAGTCATCATGCCATGT AGCTGGTGGGTGGCCCGTATCTTGGGCATGGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001011705 |
Insert Size | 1002 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001011705.1 |
RefSeq Size | 1535 bp |
RefSeq ORF | 1002 bp |
Locus ID | 11061 |
UniProt ID | O75829 |
Protein Families | Secreted Protein, Transmembrane |
MW | 37 kDa |
Gene Summary | This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206635 | LECT1 (Myc-DDK-tagged)-Human leukocyte cell derived chemotaxin 1 (LECT1), transcript variant 2 |
CNY 2,400.00 |
|
RC206635L3 | Lenti ORF clone of Human leukocyte cell derived chemotaxin 1 (LECT1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206635L4 | Lenti ORF clone of Human leukocyte cell derived chemotaxin 1 (LECT1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG206635 | LECT1 (tGFP-tagged) - Human leukocyte cell derived chemotaxin 1 (LECT1), transcript variant 2 |
CNY 4,370.00 |