United States
Germany
Japan
United Kingdom
China
MAGEA10 (NM_001011543) Human Untagged Clone
CAT＃: SC301571
MAGEA10 (untagged)-Human melanoma antigen family A, 10 (MAGEA10), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT1.10; MAGE10 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001011543 edited
ATGCCTCGAGCTCCAAAGCGTCAGCGCTGCATGCCTGAAGAAGATCTTCAATCCCAAAGT GAGACACAGGGCCTCGAGGGTGCACAGGCTCCCCTGGCTGTGGAGGAGGATGCTTCATCA TCCACTTCCACCAGCTCCTCTTTTCCATCCTCTTTTCCCTCCTCCTCCTCTTCCTCCTCC TCCTCCTGCTATCCTCTAATACCAAGCACCCCAGAGGAGGTTTCTGCTGATGATGAGACA CCAAATCCTCCCCAGAGTGCTCAGATAGCCTGCTCCTCCCCCTCGGTCGTTGCTTCCCTT CCATTAGATCAATCTGATGAGGGCTCCAGCAGCCAAAAGGAGGAGAGTCCAAGCACCCTA CAGGTCCTGCCAGACAGTGAGTCTTTACCCAGAAGTGAGATAGATGAAAAGGTGACTGAT TTGGTGCAGTTTCTGCTCTTCAAGTATCAAATGAAGGAGCCGATCACAAAGGCAGAAATA CTGGAGAGTGTCATAAAAAATTATGAAGACCACTTCCCTTTGTTGTTTAGTGAAGCCTCC GAGTGCATGCTGCTGGTCTTTGGCATTGATGTAAAGGAAGTGGATCCCACTGGCCACTCC TTTGTCCTTGTCACCTCCCTGGGCCTCACCTATGATGGGATGCTGAGTGATGTCCAGAGC ATGCCCAAGACTGGCATTCTCATACTTATCCTAAGCATAATCTTCATAGAGGGCTACTGC ACCCCTGAGGAGGTCATCTGGGAAGCACTGAATATGATGGGGCTGTATGATGGGATGGAG CACCTCATTTATGGGGAGCCCAGGAAGCTGCTCACCCAAGATTGGGTGCAGGAAAACTAC CTGGAGTACCGGCAGGTGCCTGGCAGTGATCCTGCACGGTATGAGTTTCTGTGGGGTCCA AGGGCTCATGCTGAAATTAGGAAGATGAGTCTCCTGAAATTTTTGGCCAAGGTAAATGGG AGTGATCCAAGATCCTTCCCACTGTGGTATGAGGAGGCTTTGAAAGATGAGGAAGAGAGA GCCCAGGACAGAATTGCCACCACAGATGATACTACTGCCATGGCCAGTGCAAGTTCTAGC GCTACAGGTAGCTTCTCCTACCCTGAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001011543 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001011543.1, NP_001011543.1 |
| RefSeq Size | 1610 bp |
| RefSeq ORF | 1110 bp |
| Locus ID | 4109 |
| UniProt ID | P43363 |
| Gene Summary | This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream melanoma antigen family A, 5 (MAGEA5) gene.[provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202501 | MAGEA10 (Myc-DDK-tagged)-Human melanoma antigen family A, 10 (MAGEA10), transcript variant 1 |
CNY 5,488.00 |
|
| RC202501L3 | Lenti ORF clone of Human melanoma antigen family A, 10 (MAGEA10), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202501L4 | Lenti ORF clone of Human melanoma antigen family A, 10 (MAGEA10), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG202501 | MAGEA10 (tGFP-tagged) - Human melanoma antigen family A, 10 (MAGEA10), transcript variant 1 |
CNY 7,088.00 |
其它MAGEA10产品
