MAGEA10 (NM_001011543) Human Untagged Clone

CAT#: SC301571

MAGEA10 (untagged)-Human melanoma antigen family A, 10 (MAGEA10), transcript variant 1



  "NM_001011543" in other vectors (4)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MAGEA10 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT1.10; MAGE10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001011543 edited
ATGCCTCGAGCTCCAAAGCGTCAGCGCTGCATGCCTGAAGAAGATCTTCAATCCCAAAGT
GAGACACAGGGCCTCGAGGGTGCACAGGCTCCCCTGGCTGTGGAGGAGGATGCTTCATCA
TCCACTTCCACCAGCTCCTCTTTTCCATCCTCTTTTCCCTCCTCCTCCTCTTCCTCCTCC
TCCTCCTGCTATCCTCTAATACCAAGCACCCCAGAGGAGGTTTCTGCTGATGATGAGACA
CCAAATCCTCCCCAGAGTGCTCAGATAGCCTGCTCCTCCCCCTCGGTCGTTGCTTCCCTT
CCATTAGATCAATCTGATGAGGGCTCCAGCAGCCAAAAGGAGGAGAGTCCAAGCACCCTA
CAGGTCCTGCCAGACAGTGAGTCTTTACCCAGAAGTGAGATAGATGAAAAGGTGACTGAT
TTGGTGCAGTTTCTGCTCTTCAAGTATCAAATGAAGGAGCCGATCACAAAGGCAGAAATA
CTGGAGAGTGTCATAAAAAATTATGAAGACCACTTCCCTTTGTTGTTTAGTGAAGCCTCC
GAGTGCATGCTGCTGGTCTTTGGCATTGATGTAAAGGAAGTGGATCCCACTGGCCACTCC
TTTGTCCTTGTCACCTCCCTGGGCCTCACCTATGATGGGATGCTGAGTGATGTCCAGAGC
ATGCCCAAGACTGGCATTCTCATACTTATCCTAAGCATAATCTTCATAGAGGGCTACTGC
ACCCCTGAGGAGGTCATCTGGGAAGCACTGAATATGATGGGGCTGTATGATGGGATGGAG
CACCTCATTTATGGGGAGCCCAGGAAGCTGCTCACCCAAGATTGGGTGCAGGAAAACTAC
CTGGAGTACCGGCAGGTGCCTGGCAGTGATCCTGCACGGTATGAGTTTCTGTGGGGTCCA
AGGGCTCATGCTGAAATTAGGAAGATGAGTCTCCTGAAATTTTTGGCCAAGGTAAATGGG
AGTGATCCAAGATCCTTCCCACTGTGGTATGAGGAGGCTTTGAAAGATGAGGAAGAGAGA
GCCCAGGACAGAATTGCCACCACAGATGATACTACTGCCATGGCCAGTGCAAGTTCTAGC
GCTACAGGTAGCTTCTCCTACCCTGAATAA
Restriction Sites Please inquire     
ACCN NM_001011543
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001011543.1, NP_001011543.1
RefSeq Size 1610 bp
RefSeq ORF 1110 bp
Locus ID 4109
UniProt ID P43363
Gene Summary This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream melanoma antigen family A, 5 (MAGEA5) gene.[provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...