United States
Germany
Japan
United Kingdom
China
PDLIM5 (NM_001011515) Human Untagged Clone
CAT＃: SC301566
PDLIM5 (untagged)-Human PDZ and LIM domain 5 (PDLIM5), transcript variant 4
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ENH; ENH1; L9; LIM |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001011515, the custom clone sequence may differ by one or more nucleotides
ATGAGCAACTACAGTGTGTCACTGGTTGGCCCAGCTCCTTGGGGTTTCCGGCTGCAGGGC GGTAAGGATTTCAACATGCCTCTGACAATCTCTAGTCTAAAAGATGGCGGCAAGGCAGCC CAGGCAAATGTAAGAATAGGCGATGTGGTTCTCAGCATTGATGGAATAAATGCACAAGGA ATGACTCATCTTGAAGCCCAGAATAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACT CTGCAAAGAGCATCTGCTGCACCCAAGCCTGAGCCGGTTCCTGTTCAAAAGCCCACAGTC ACCAGCGTGTGTTCCGAGACTTCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAG GGTGACAGTAAACAGCAAAATGGGAAAATCCCACCTAAACGCCCACCAAGAAAACACATT GTGGAGCGCTATACAGAGTTTTATCATGTACCCACTCACAGTGATGCCAGCAAGAAGAGA CTGATTGAGGATACTGAAGACTGGCGTCCAAGGACTGGAACAACTCAGTCTCGCTCTTTC CGAATCCTTGCCCAGATCACTGGGACTGAACATTTGAAAGAATCTGAAGCCGATAATACA AAGAAGGCAAAGGAAAAGATACCCCTTCACGTCTTTAGTCCCAAATACACAAAATTACGT GACTGGCACCATGAAGTTTCAGCACGTGCTCTTAACGTACAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001011515 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001011515.1, NP_001011515.1 |
| RefSeq Size | 2001 bp |
| RefSeq ORF | 705 bp |
| Locus ID | 10611 |
| UniProt ID | Q96HC4 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (4) has multiple differences in the coding region, lacks several 3' exons but contains an alternate 3' exon, and it thus has an alternate 3' coding region and 3' UTR, compared to isoform a. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223308 | PDLIM5 (Myc-DDK-tagged)-Human PDZ and LIM domain 5 (PDLIM5), transcript variant 4 |
CNY 3,990.00 |
|
| RC223308L3 | Lenti-ORF clone of PDLIM5 (Myc-DDK-tagged)-Human PDZ and LIM domain 5 (PDLIM5), transcript variant 4 |
CNY 5,890.00 |
|
| RC223308L4 | Lenti-ORF clone of PDLIM5 (mGFP-tagged)-Human PDZ and LIM domain 5 (PDLIM5), transcript variant 4 |
CNY 5,890.00 |
|
| RG223308 | PDLIM5 (tGFP-tagged) - Human PDZ and LIM domain 5 (PDLIM5), transcript variant 4 |
CNY 4,370.00 |
