United States
Germany
Japan
United Kingdom
China
DUSP13 (NM_001007271) Human Untagged Clone
CAT＃: SC301204
DUSP13 (untagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BEDP; DUSP13A; DUSP13B; MDSP; SKRP4; TMDP |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001007271, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGACCTCTCTCCCAGAGCTGGGGGGAGAGGACAAAGCCACGCCTTGCCCCAGC ATCCTGGAGCTGGAGGAGCTCCTGCGGGCAGGGAAGTCTTCTTGCAGCCGTGTGGACGAA GTTTGGCCCAACCTTTTCATAGGAGATGCGGCCACGGCAAACAACCGCTTTGAGCTGTGG AAGCTGGGCATCACCCACGTGCTGAACGCCGCCCACAAGGGCCTCTACTGTCAGGGCGGC CCTGACTTCTACGGCAGCAGTGTGAGCTACCTGGGGGTGCCAGCCCACGACCTCCCTGAT TTTGACATCAGTGCCTACTTCTCCTCTGCGGCTGACTTCATCCACCGTGCCCTCAACACG CCTGGGGCCAAGGTCCTGGTGCACTGTGTGGTGGGCGTGAGCCGCTCTGCCACGCTGGTC CTGGCCTACCTCATGCTGCACCAGCGGCTGTCCCTGCGCCAGGCGGTGATCACCGTGAGG CAGCACCGATGGGTCTTCCCCAACCGAGGCTTCCTGCACCAGCTCTGCAGGCTGGACCAG CAACTGCGGGGTGCCGGCCAGAGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001007271 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001007271.1, NP_001007272.1 |
| RefSeq Size | 1788 bp |
| RefSeq ORF | 567 bp |
| Locus ID | 51207 |
| UniProt ID | Q6B8I1 |
| Protein Families | Druggable Genome, Phosphatase |
| Gene Summary | Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In mouse, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1, also called MDSP. Isoform 1 is expressed from the upstream open reading frame and is expressed in skeletal muscle. CCDS Note: This CCDS representation is supported by the mRNAs AY674051.1 and AY040091.1. The transcript is a candidate for nonsense-mediated mRNA decay (NMD); however, the protein is represented based on demonstration of the endogenous protein in mouse tissues in PMID:15252030, and because there are no non-NMD transcripts that can encode this protein in either human and mouse. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218804 | DUSP13 (Myc-DDK-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 1 |
CNY 3,990.00 |
|
| RC218804L3 | Lenti-ORF clone of DUSP13 (Myc-DDK-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 1 |
CNY 5,890.00 |
|
| RC218804L4 | Lenti-ORF clone of DUSP13 (mGFP-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 1 |
CNY 5,890.00 |
|
| RG218804 | DUSP13 (tGFP-tagged) - Human dual specificity phosphatase 13 (DUSP13), transcript variant 1 |
CNY 5,440.00 |
