United States
Germany
Japan
United Kingdom
China
WDR9 (BRWD1) (NM_001007246) Human Untagged Clone
CAT＃: SC301186
BRWD1 (untagged)-Human bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant 3
CNY 1,320.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C21orf107; DCAF19; N143; WDR9; WRD9 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001007246, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGCCGTCGTCCGCCCGACGCCCGGTGCCTCTCATCGAGTCGGAGCTGTACTTC CTTATCGCCCGGTACCTATCGGCGGGCCCGTGTCGGAGAGCGGCCCAGGTGCTGGTGCAG GAGCTGGAGCAGTACCAGTTGTTGCCGAAGAGATTGGACTGGGAGGGCAACGAGCACAAC AGGAGCTACGAGGAGTTGGTCTTGTCCAATAAGCATGTGGCTCCTGATCATCTTTTGCAA ATCTGCCAGCGCATCGGTCCTATGTTGGATAAAGAAATTCCACCCAGTATTTCAAGAGTC ACTTCTTTACTTGGTGCAGGAAGGCAGTCTTTGCTACGTACAGCAAAAGGTACCTTAATT TGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001007246 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001007246.1, NP_001007247.1 |
| RefSeq Size | 2488 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 54014 |
| UniProt ID | Q9NSI6 |
| Gene Summary | This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011] Transcript Variant: This variant (3) lacks multiple 3' exons and has a shorter alternate 3' sequence, as compared to variant 1. The encoded isoform C has a much shorter and distinct C-terminus, as compared to isoform A. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217768 | BRWD1 (Myc-DDK-tagged)-Human bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant 3 |
CNY 3,990.00 |
|
| RC217768L3 | Lenti-ORF clone of BRWD1 (Myc-DDK-tagged)-Human bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant 3 |
CNY 5,890.00 |
|
| RC217768L4 | Lenti-ORF clone of BRWD1 (mGFP-tagged)-Human bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant 3 |
CNY 5,890.00 |
|
| RG217768 | BRWD1 (tGFP-tagged) - Human bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant 3 |
CNY 4,370.00 |
