SIAH Interacting Protein (CACYBP) (NM_001007214) Human Untagged Clone
CAT#: SC301165
CACYBP (untagged)-Human calcyclin binding protein (CACYBP), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GIG5; PNAS-107; S100A6BP; SIP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301165 representing NM_001007214.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAACAGAAATCACAGAAGAAAGCAGAACTTCTTGATAATGAAAAACCAGCTGCTGTGGTTGCTCCC ATTACAACGGGCTATACGGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATC TACATTACCTTAACTGGAGTTCATCAAGTTCCCACTGAGAATGTGCAGGTGCATTTCACAGAGAGGTCA TTTGATCTTTTGGTAAAGAATCTAAATGGGAAGAGTTACTCCATGATTGTGAACAATCTCTTGAAACCC ATCTCTGTGGAAGGCAGTTCAAAAAAAGTCAAGACTGATACAGTTCTTATATTGTGTAGAAAGAAAGTG GAAAACACAAGGTGGGATTACCTGACCCAGGTTGAAAAGGAGTGCAAAGAAAAAGAGAAGCCCTCCTAT GACACTGAAACAGATCCTAGTGAGGGATTGATGAATGTTCTAAAGAAAATTTATGAAGATGGAGACGAT GATATGAAGCGAACCATTAATAAAGCCTGGGTGGAATCAAGAGAGAAGCAAGCCAAAGGAGACACGGAA TTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007214 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007214.1 |
RefSeq Size | 2875 bp |
RefSeq ORF | 558 bp |
Locus ID | 27101 |
UniProt ID | Q9HB71 |
Protein Pathways | Wnt signaling pathway |
MW | 21.2 kDa |
Gene Summary | The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an alternate 5' exon, and uses a downstream AUG start codon, as compared to variant 1. The encoded isoform 2 has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209815 | CACYBP (Myc-DDK-tagged)-Human calcyclin binding protein (CACYBP), transcript variant 2 |
CNY 2,400.00 |
|
RC209815L3 | Lenti ORF clone of Human calcyclin binding protein (CACYBP), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209815L4 | Lenti ORF clone of Human calcyclin binding protein (CACYBP), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG209815 | CACYBP (tGFP-tagged) - Human calcyclin binding protein (CACYBP), transcript variant 2 |
CNY 4,000.00 |
其它SIAH Interacting Protein产品