Syntenin (SDCBP) (NM_001007069) Human Untagged Clone
CAT#: SC301141
SDCBP (untagged)-Human syndecan binding protein (syntenin) (SDCBP), transcript variant 4
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MDA-9; MDA9; ST1; SYCL; TACIP18 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001007069, the custom clone sequence may differ by one or more nucleotides
ATGTCTCTCTATCCATCTCTCGAAGACTTGAAGGTAGACAAAGTAATTCAGGCTCAAACT GCTTTTTCTGCAAACCCTGCCAATCCAGCAATTTTGTCAGAAGCTTCTGCTCCTATCCCT CACGATGGAAATCTCTATCCCAGACTGTATCCAGAGCTCTCTCAATACATGGGGCTGAGT TTAAATGAAGAAGAAATACGTGCAAATGTGGCCGTGGTTTCTGGTGCACCACTTCAGGGG TTGGTAGCAAGACCTTCCAGTATAAACTATATGGTGGCTCCTGTAACTGGTAATGATGTT GGAATTCGTAGAGCAGAAATTAAGCAAGGGATTCGTGAAGTCATTTTGTGTAAGGATCAA GATGGAAAAATTGGACTCAGGCTTAAATCAATAGATAATGGTATATTTGTTCAGCTAGTC CAGGCTAATTCTCCAGCCTCATTGGTTGGTCTGAGATTTGGGGACCAAGTACTTCAGATC AATGGTGAAAACTGTGCAGGATGGAGCTCTGATAAAGCGCACAAGGTGCTCAAACAGGCT TTTGGAGAGAAGATTACCATGACCATTCGTGACAGGCCCTTTGAACGGACGATTACCATG CATAAGGATAGCACTGGACATGTTGGTTTTATCTTTAAAAATGGAAAAATAACATCCATA GTGAAAGATAGCTCTGCAGCCAGAAATGGTCTTCTCACGGAACATAACATCTGTGAAATC AATGGACAGAATGTCATTGGATTGAAGGACTCTCAAATTGCAGACATACTGTCAACATCT GGGACTGTAGTTACTATTACAATCATGCCTGCTTTTATCTTTGAACATATTATTAAGCGG ATGGCACCAAGCATTATGAAAAGCCTAATGGACCACACCATTCCTGAGGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001007069 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007069.1, NP_001007070.1 |
RefSeq Size | 2170 bp |
RefSeq ORF | 894 bp |
Locus ID | 6386 |
UniProt ID | O00560 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a shorter isoform (isoform 3). Variants 4 and 5 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216116 | SDCBP (Myc-DDK-tagged)-Human syndecan binding protein (syntenin) (SDCBP), transcript variant 4 |
CNY 3,990.00 |
|
RC216116L3 | Lenti-ORF clone of SDCBP (Myc-DDK-tagged)-Human syndecan binding protein (syntenin) (SDCBP), transcript variant 4 |
CNY 5,890.00 |
|
RC216116L4 | Lenti-ORF clone of SDCBP (mGFP-tagged)-Human syndecan binding protein (syntenin) (SDCBP), transcript variant 4 |
CNY 5,890.00 |
|
RG216116 | SDCBP (tGFP-tagged) - Human syndecan binding protein (syntenin) (SDCBP), transcript variant 4 |
CNY 4,370.00 |