WBP5 (TCEAL9) (NM_001006614) Human Untagged Clone

CAT#: SC301075

WBP5 (untagged)-Human WW domain binding protein 5 (WBP5), transcript variant 4



  "NM_001006614" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TCEAL9 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms WBP5; WEX6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001006614, the custom clone sequence may differ by one or more nucleotides
ATGAAATCCTGTCAAAAAATGGAAGGAAAACCAGAAAATGAGAGTGAACCAAAGCATGAG
GAAGAGCCAAAGCCTGAGGAAAAGCCAGAAGAGGAGGAGAAGCTAGAGGAGGAGGCCAAA
GCAAAAGGAACTTTTAGAGAAAGGCTGATTCAATCTCTCCAGGAGTTTAAAGAAGATATA
CACAACAGGCATTTAAGCAATGAAGATATGTTTAGAGAAGTGGATGAAATAGATGAGATA
AGGAGAGTCAGAAACAAACTTATAGTGATGCGTTGGAAGGTTAATCGAAACCATCCTTAC
CCCTATTTAATGTAG
Restriction Sites Please inquire     
ACCN NM_001006614
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006614.1, NP_001006615.1
RefSeq Size 1020 bp
RefSeq ORF 315 bp
Locus ID 51186
UniProt ID Q9UHQ7
Gene Summary The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein. This gene also encodes a domain with similarity to the transcription elongation factor A, SII-related family. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...