VPS24 (CHMP3) (NM_001005753) Human Untagged Clone

CAT#: SC301031

CHMP3 (untagged)-Human vacuolar protein sorting 24 homolog (S. cerevisiae) (VPS24), transcript variant 2



  "NM_001005753" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CHMP3 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-149; NEDF; VPS24
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301031 representing NM_001005753.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCAGGTCAAGGAAGGCTGTGAGCAAGCTGTATGCATCCAAAGCACACATGAACTCAGTGCTCATG
GGGATGAAGAACCAGCTCGCGGTCTTGCGAGTGGCTGGTTCCCTGCAGAAGAGCACAGAAGTGATGAAG
GCCATGCAAAGTCTTGTGAAGATTCCAGAGATTCAGGCCACCATGAGGGAGTTGTCCAAAGAAATGATG
AAGGCTGGGATCATAGAGGAGATGTTAGAGGACACTTTTGAAAGCATGGACGATCAGGAAGAAATGGAG
GAAGAAGCAGAAATGGAAATTGACAGAATTCTCTTTGAAATTACAGCAGGGGCCTTGGGCAAAGCACCC
AGTAAAGTGACTGATGCCCTTCCAGAGCCAGAACCTCCAGGAGCGATGGCTGCCTCAGAGGATGAGGAG
GAGGAGGAAGAGGCTCTGGAGGCCATGCAGTCCCGGCTGGCCACACTCCGCAGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001005753
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005753.2
RefSeq Size 3133 bp
RefSeq ORF 471 bp
Locus ID 51652
UniProt ID Q9Y3E7
Protein Pathways Endocytosis
MW 17.3 kDa
Gene Summary This gene encodes a protein that sorts transmembrane proteins into lysosomes/vacuoles via the multivesicular body (MVB) pathway. This protein, along with other soluble coiled-coil containing proteins, forms part of the ESCRT-III protein complex that binds to the endosomal membrane and recruits additional cofactors for protein sorting into the MVB. This protein may also co-immunoprecipitate with a member of the IFG-binding protein superfamily. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ring finger protein 103 (RNF103) gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region, compared to variant 1. This results in translation initiation from a downstream start codon and an isoform (2, also known as Vps24beta) that has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...