EDA (NM_001005610) Human Untagged Clone
CAT#: SC301004
EDA (untagged)-Human ectodysplasin A (EDA), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ECTD1; ED1; ED1-A1; ED1-A2; EDA-A1; EDA-A2; EDA1; EDA2; HED; HED1; ODT1; STHAGX1; TNLG7C; XHED; XLHED |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301004 representing NM_001005610.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCTACCCGGAGGTGGAGCGCAGGGAACTCCTGCCTGCAGCAGCGCCGCGGGAGCGAGGGAGCCAG GGCTGCGGGTGTGGCGGGGCCCCTGCCCGGGCGGGCGAAGGGAACAGCTGCCTGCTCTTCCTGGGTTTC TTTGGCCTCTCGCTGGCCCTCCACCTGCTGACGTTGTGCTGCTACCTAGAGTTGCGCTCGGAGTTGCGG CGGGAACGTGGAGCCGAGTCCCGCCTTGGCGGCTCGGGCACCCCTGGCACCTCTGGCACCCTAAGCAGC CTCGGTGGCCTCGACCCTGACAGCCCCATCACCAGTCACCTTGGGCAGCCGTCACCTAAGCAGCAGCCA TTGGAACCGGGAGAAGCCGCACTCCACTCTGACTCCCAGGACGGGCACCAGGGACACCAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001005610 |
Insert Size | 408 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001005610.3 |
RefSeq Size | 858 bp |
RefSeq ORF | 408 bp |
Locus ID | 1896 |
UniProt ID | Q92838 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
MW | 14 kDa |
Gene Summary | The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (3, also known as EDA-O) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215628 | EDA (Myc-DDK-tagged)-Human ectodysplasin A (EDA), transcript variant 3 |
CNY 2,400.00 |
|
RC215628L3 | Lenti ORF clone of Human ectodysplasin A (EDA), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215628L4 | Lenti ORF clone of Human ectodysplasin A (EDA), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG215628 | EDA (tGFP-tagged) - Human ectodysplasin A (EDA), transcript variant 3 |
CNY 4,370.00 |